Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig52  (registered. 2003)
Contig Information
Length 824 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit Os12g0540000 [Oryza sativa (japonica cultivar-group)] >gi|77556555|gb|ABA99351.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649455|dbj|BAF29967.1| Os12g0540000 [Oryza sativa (japonica cultivar-group)] >gi|125579613|gb|EAZ20759.1| hypothetical protein OsJ_034968 [Oryza sativa (japonica cultivar-group)] >gi|215766243|dbj|BAG98471.1| unnamed protein product [Oryza sativa Japonica Group]
Score 304
Evalue 5.86331e-26
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig52
ATGCGCCGCCTCCCGTCCTTGTTCTTGCTTCAAACCCCCACCCGTCCCCAACCCTTGACCTGAGAGAGGGAGAGAGAGAGGGAGAGAGAGAGAGAGAAGA
GAAATCCAAAGAAATTGCCATCCATCCATGGCGTCCGGCTGCTGCGTCCTCGTCGATTCCGGGGCGTACATCGACGACACCAACGACAGCACCAACGACA
GCACGGCCCAAGAGTATACTAATACAGGCAGTCAGATCGTGGTTTCCTTATGGCCTGCTCACCCGCCGATCCCCTCCCGTCTCTCCGTGCACTGCAAGTG
GATGCGTCCCGGCCATGTCTTCTTCCATGAACCCAAGATCCTTTGCGCGGCGGACTGCTTCTTTGTCCTCCGCATCGCCATCGGCCGCAGCCCCCCACCC
ATAAACATCACACAGAAGCATCACACCAACTCGGTCATCACCATCGGGAGCAGGGGACTCGTTGGCTGGGTTGATCTCTGGCACGGAATACTGCTCTACG
ACGTGCTCCGTGACGACAACGACAAAGTACGCCGTGTGCCGCTGCCCGTAAGGCTGGGAAGCCATGGCGGCAATGCGCTTGCTTGCTGTCCAAAGCCTTA
CCGAAGCGTTGCTGTCCTGGGGGATTGCCTCAAGTTTGTCGAGTTGGAAGTCTCTGGTGATCGTCTTCCTGGTAAAGACCCTGAAACCAGGGGCCCCAAT
ATCAGAATTGATGACTGGGCACTCACCACATATACCAACTGCAACATCACCGGCGATCCCGACGATTGGATAATCGACTTCACTGTCAATGCATCTGCCA
TCCGAATTGACACAGCAATGCGGT
page-top