Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig51  (registered. 2003)
Contig Information
Length 755 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein [Cryptosporidium muris RN66] >gi|209557797|gb|EEA07842.1| hypothetical protein CMU_029160 [Cryptosporidium muris RN66]
Score 81
Evalue 3.58797
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig51
CATCACCTCCTTACAATCAATCTACCCAATTTATATAGGTTTTCAAATTCCTTGGTTATCAGGAAGTCATCTCAGAGATCATACAGAAAAATAGGAAGAA
AAGTGAGGCTAATGGTGGGCTCCTAAATGGGATAGGAAGGAAATCGAGGCTAATGGTGGGTTTGGCTACTGATGAGGAAAGTAATAAGAAGGAAGGACAA
AAGGCTAAAATTGGAGCTAGCAAAAACACATATAGATGAGGAAAGTAATAAGAAGGAAAGGAGGGATTTCGAGGGATTGAAAGCAAAAAAGGTAGGAAAG
TGAGAAGTTGTCCCGTAACAATAAGGAAAGGACGGGATTCGGGGATTGATCTACACTTCTACACTACTATTAAACAAGAAAACATGGCGGACGAAAACTC
TGCCGGACCCACGCTCGCACAAGATCAGAACGGTTCCACCAATTCTGTTCACGTCCTAACAACGAATGGCTAAACCTTGCCCACCGGGACATACGTCGCA
GCCGCAGAGCCTGTCCTGCGCCATCGCAGTGGACGACGACCACGCCGAAGAGCTTCTCGCGAACGCAGGTGCGGACTATCCTCTTGTGCGCAATACATGG
TCAGTTCCATCCCAGTTAATCTTAGTGTCTTTCTTCGATGTCGCTGTTCAGACGCACACTGCNGTGAGACGTCGGCGCCGCAAGCCACTATTGCACCATT
GCCGCCCAGCCCAGTTTTGGCCATCGCCGCCTTCCCGCAGCCGCCCGACATAGGC
page-top