Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig50  (registered. 2003)
Contig Information
Length 807 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 1
Homology (BLAST) Top Hit hypothetical protein OsI_27446 [Oryza sativa Indica Group]
Score 1090
Evalue 4.04901e-117
Total Hit Count 88
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig50
AGGATCTTCAGAGTGGTGACAGGGTAACTCAAGGTCTAAGTGCTGTCTGGAACCTTATCATGTTAAGACCTCCAAATCGGGACAGATGTCTGGACATTGC
TTTGCAGAGTTCAATCAATCGTCTAGATGAGGTCCGCATGAAGGCAATACGTTTGGTAGCAAATAAACTATTTCCCATGGCAAGCATTTCCAAAAGGATT
GAAGATTTTGCAAATGAAAAACTTAATTCAGTCCTAGAAGTGATTCCAGCGGCTGAATCTGCGTCAGCTGCTGAGATGGCCACACCCGAGGTTCACCAGG
ATGGTGGTTTAGAAAATTTATCCTCGGTAGCAGATGCTCTAACTTTGATGTCGCTGTATTTTGCTCTGTGTACCAAGAAGCACTCCCTTCTCCGACGTGT
ATTTGAAATATATGGCAGTCTTCCACAGGCTGCCAAACAGGCAGTTCACAGACAAGTTTTACAGACTCTCACTGATGGTGCAGTGCCATCTCAAGATCTG
ATTTCTTCCATAAAGAACTTATATTCAAAAACTAAGGATACTGAGTTCCTTTTCCCAGTCATGGCTCATCTGCCAAAAGATGAGATTCTGTCTGTGTTTC
CCAATATTGTTAATCTTCCGGTGGATAAGTTTCAAGTTGCCCTTTCTCGAATCCTGCAGGGATCACCACAACATGGCCCTATTCTTGACCCATCAGAAAT
TTTGATTGCGATTCATGTAATAGATCCTGAAAAAGAAGGAATACCACTGAAAAAGGTTATGGATGCATGTGCTGCCTGCTTCGAGCAAAGGACAACATTC
ACTCAGC
page-top