Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig49  (registered. 2003)
Contig Information
Length 674 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit hypothetical protein RHA1_ro05016 [Rhodococcus jostii RHA1] >gi|110821513|gb|ABG96797.1| conserved hypothetical protein [Rhodococcus jostii RHA1]
Score 83
Evalue 1.67722
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig49
CTCGTCTTTGTTTCGTCGCGACACAATCGTGAGGTGCCCCCTAATCTTGTTCCTCCTCTTCCTTTTCGATTTACACAAGTTAGAATCCAGGTTATAATTT
TGTGATTTCGTAGGTATACTATATGTTTTGCGTGGTCTGTTCTCTTTGATTCAGGATGTCTGAAGAGGTCGTTCCGATTTGCCTCATCAGTACATGTCTA
TCCCTTAAGCCAAGTCCGTGATGGCCGAATCAGTCGTTGATGGGTCAGATTTTCTGGCGGTTCGTGTCTATCCCTTAAGCCAAGTTGTGTAGGATGTTGT
GTCATCCGAAGAGGTAGTTCCTGTGCCTCTCAAGTAGATGTCTATCGCTGATCCAAGTTCGTCTGAGATTTTCTGACGACCCGCTTGTGACGCCTGAATC
AGTTGATGCGTCAGATTCGTCAGTTTATGTTGTATCCGGGCACACCAACGGTTCATCTTCATCGTCTGCTCGAAGAAGGCTCTTANGTGCTTGCTGCGGT
CCACAAGGTGCCCGAGGACATCCGATTTATGGTTCATGTTCGTGGTTCCTTTAGCTAACCANATGATGCTTTGCCCGTCTCCAAACATCACAGGAAGGTA
ATTGTGTTGGTAAGCTGATTGGCGCGCATGNGTGTACGTGCGTGCCTATTGNATTATTGCCTGCTGTATNACAT
page-top