Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig48  (registered. 2003)
Contig Information
Length 881 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit Os03g0275400 [Oryza sativa (japonica cultivar-group)] >gi|108707456|gb|ABF95251.1| DHHC zinc finger domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548178|dbj|BAF11621.1| Os03g0275400 [Oryza sativa (japonica cultivar-group)] >gi|215767922|dbj|BAH00151.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1068
Evalue 1.6881e-114
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig48
CACAGTCCAAATGATACACAAACCAATGAATATGAATCAGTGTTACAGTAACAGGCAAAAAATATCTTCAGGAATCTTGAGTGGGTGTTCTCCGGTCTCG
GTGCGTTTTAGATTATACTTGTATTATTACGGCTTCAGGAACTCCCTAATGTTACAAAGCATGCCTTTGTCGTATGGATTGACAAACTTGACTTCAAAAT
CTCTTAGCTATAAGAAACAGCAAACGAGAAGACGACCTGCAATTGGTGAAGAAAGAGTCCAAAGCATGGGAAATTTGACATTACCCACTCATGCGTCCTG
ATGTTGAAGCAGATGCCGTACACATGCCATATCAGGAACACAACCTGCCATACCACTTGGAGGACTGAGAAGAGCATTGTGCCGATCACCATGTTTAGAG
ACAAATGATTCTCAGTTATTAAAGTTCCTGAGGTTATGCATCTAGTTATATATTTAGTTGAACACATTGTATATGTCGATTCAGCAACAACAAATCCTGT
CAGAAGTGCCATAAATAACCTATGATTTTTCTGTCCTATGCAATTACCAAATGCAGGGCAATGGTGGTCATAACCTCTAACATTTGCTTTGCAACAGTTA
CAATGCCTCACCCTTGAGAGTGATGGGTACTTCTCACTCGAGCATATAGCATCCACGAAATCCTTGCAGCCAGCCTCTTCCAAAAATGAAGATTCGTATG
CAACAATGCCGGGATCACCAGAAAGAATCCTGTAAAGTCCCCACAGAAGCAGTGCACACTCAGCATTAATCAGCATGTCTAGTAGAGAAGAGGTATCTCT
CCGGATGACGAATAGGTAGACGCCCCACAAAAACAGCACATTGAACAGCACGAACAGCGGCGCCGACGCGGCCACTCCGAT
page-top