Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig44  (registered. 2003)
Contig Information
Length 821 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit Os01g0900800 [Oryza sativa (japonica cultivar-group)] >gi|56784863|dbj|BAD82103.1| putative helix-loop-helix protein 1A [Oryza sativa Japonica Group] >gi|113534637|dbj|BAF07020.1| Os01g0900800 [Oryza sativa (japonica cultivar-group)] >gi|215687014|dbj|BAG90828.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218189543|gb|EEC71970.1| hypothetical protein OsI_04807 [Oryza sativa Indica Group]
Score 179
Evalue 5.40866e-21
Total Hit Count 41
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig44
ATGTCCGAGGATACAACAGGAGCATAATAAATAACATTTTGCTTCTGTCTAACTTATGAGCACATAAGCCCTTTATTTACTCTAGGAATATCTCGTACTC
TTTAGCTATTTTTCTAAGTGCATGCCCATGGATCTGAGTAAGCCGCTTCTTCAATATTGAAGAGAGAAGTTTGAGGTTGTCCCACTGTTGAAATTAGACT
GGGCATTATTCTGTAGGGCTTAGGGCACAGAATATCCTTGTGACCTTGTCCATGTAGGGAATGAGGTCTTGCAGCCTCCTTAGCCTCTGGTTGATCCTTG
TTCTTCTTTCCCTCCCAAGCGATGCTCTGCGGATCAGTGGTGCAGCCACGCTTGGCGTGGACTCTGCAGTCGGCGGAGTCCTGCTGCAGCTGCAGGTAGT
CGTCCATGCTGGGCATGTCCAGCTCGAGAGGGCTAACTGAATCTGGGAGTCAATGTTGCTGAAGCTAGTGACCATGCCGACATCGCTGTCGCCGAGCACC
TCGGCCTTCTTGCTGCCGGGCGCTGAGAACATGATGTTGGAGTTGGTGTCGTCCCAGGTGCTCATGGAGAAGATCCTCAAGAGGTCACTCAAGCCGTTGC
CGGCAGCGATGCTCTCGCCGACGTCCGCGGGCGGCATCGGCACGGGCATGGCCATCTCCATCTCTGTGATGGACGACATCATGTCCTGCTGCCTCAAGAA
GCTCCACAACGAGCCCAGCCTCCTCTGATGTGCCATCACGTCNACGTTGCCTCCTCCGTGCGAATGCAAGTAGCTGATTCCCATCCTTCCTCTCATGCCA
CCCATGCCGCATTGCCTGTGC
page-top