Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig43  (registered. 2003)
Contig Information
Length 724 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Homology (BLAST) Top Hit mediator complex subunit SOH1 [Zea mays]
Score 337
Evalue 5.66541e-52
Total Hit Count 145
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig43
CAAGTTTCAGCAAGTAAAGATTCCATTCAACTACATCAAAGGCCAGGATAAGATAAATGATCAAGTCAACCAAGGGCCAAGTGCGCATGCCACGTTGAGA
ACTCCAGCTGCTCCAAAGCAGGAGCTGCTTCGAACTTGTCTGCTACTTCAAAGGTCTACCAACAGGAAACAGGGAGGTGAGTTTCCACTTCTCTGGGATG
CCGTCAGCCGTGAAGTTGATCAATATGTTTCACTAGCCCATCTTTCTCTTTCTACCACCCATAACATTTCTCATCTCATTCTTTGGGTTGTTGGCGCCAG
GAGTTCCTATAAACTGCATGGGGGGCATTGCAGATGCACCAACAGCTGACATAGTTGGCAAAGACGATGGTGGTGCAGGAACAGGCGGAGGCGTCGGCAC
TGGTGCTGGTGCTGATGCAGGCGCAGGAGTTGGTTCGGGAGGAGGACGCGGCAGGATGTGCTTCAGTCTATTGTTCCTGTAGTTTTTCCAGAAGAAATAT
TGCTGCCTATGAGCAACTTCATTATGTATTTGATGTACTCCGGACGCTGCCAATACTTGAGGTACTTGAGATACCCGATGAACGCCTCATCCTCAAAGTA
CCGATTCTGCGCTAGATAGTTGATGTAGATGGGGTTGGCGAGGCACTGGATGAACTCCAGCTCCAGTAGGAACCGCTGCCTCCCGTCGTCAGGATCCTTG
TACGGCGGCTGCTTCNCGCCCGTC
page-top