Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig41  (registered. 2003)
Contig Information
Length 851 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Homology (BLAST) Top Hit Os04g0488000 [Oryza sativa (japonica cultivar-group)] >gi|75233131|sp|Q7XUF4|CDKG2_ORYSJ RecName: Full=Cyclin-dependent kinase G-2; Short=CDKG;2 >gi|158512881|sp|A2XUW1|CDKG2_ORYSI RecName: Full=Cyclin-dependent kinase G-2; Short=CDKG;2 >gi|38344237|emb|CAD41330.2| OJ991113_30.14 [Oryza sativa (japonica cultivar-group)] >gi|113564718|dbj|BAF15061.1| Os04g0488000 [Oryza sativa (japonica cultivar-group)] >gi|125548799|gb|EAY94621.1| hypothetical protein OsI_16398 [Oryza sativa Indica Group] >gi|215767108|dbj|BAG99336.1| unnamed protein product [Oryza sativa Japonica Group]
Score 918
Evalue 3.95955e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig41
GAGCATTGTTTACAATGGTATCAATCTGGAATATTTTACATACAGAGGTTCCAAAGGTGAAACAGGTGTAAGTGTGTAGCCAATAAAGCCAACAGGCCAA
ACCTTACGATGGAGGCAGGTTAGATTTGCTTTCATGATCAATCTGGTCGGAGTGCTAATCCTGTGAAAAGAATTCTATGATGGGCCACAAGTCACTAAGC
ACAAAGCCTCAGAAGCCATCTGACCTCACTGATTCAGGTTGAAGCATAGCAGTCAGTACGAACAAAACCCAAGCAAGCGGTTTGAGCTCAGCCGAAAAGG
CCACGGTTGCCTTTTGCTTGCAGTTCTTTCAACCGTTGCTCCTCTAGAGGATCAGGACTCTTCATATACCGTCTGGTACGCCTGTCCAGTTCGTTTAGAG
CTGGAAATGTTGGCATGAAGTCCTTCGACTTAGGTAGAGGTACTTCACTGAACCATGGATGCTCCAATGCAGCCTCCGCTGATATACGCTTCGCAGGATC
ATAAGTTAAGAGCTTATTCAACAGATCAAAACCAGCTTCAGATAGGTTTGGACGCCCAGAAAAAGACGCAGCTGGGAACTTATCCCTTAATCTGTTGTAC
GGTTGCTTAACAAAGTTGACTTTGACACCAGGTAACTTGGCATAACCAGGCCATATCTTCTCATTAGGTGTGCCAAGTGTTCTAAATATCTTGTCTAGCT
GTTCAAACTCTGTTTTTCCATTGAACAGTGGTTCTTTGGCGAGAAGCTCTGCCATAATGCAGCCCACGGACCACATGTCAATAGCAGTAGAGTATTCCTT
TGTTCCTAGCAATAGTTCAGGTGACCTGTACCACAAAGTCACAACCAATTG
page-top