Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig39  (registered. 2003)
Contig Information
Length 702 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit hypothetical protein OsI_37749 [Oryza sativa Indica Group]
Score 85
Evalue 0.000556695
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig39
GCTCGATAATTACATTGTTCAACCCTTGATTCAATACTCTGAAGACAAATACACCAAAAATATAATTTTTACACACACCATGATAGCATCATATCCATCC
CCACACACATCACACTAACATCAGACCCAAACATAAGAGAGAGGAGATGAGACAGCGAGGCCAACACATGGGATGTTGCTGCACCGATATGCCGAGGGTC
GCGGCTGACAGCAGGGGCAGGAGGGCAGGGGTGCTGCTGTGGCCTCAAGGCGATGCAGATGCGGATGGGTACGTCGTGGGCTCGTGGTAGACCGACGATG
GCAGCCGACACAGGCAGTTGCCGGGTGGATGTGGGTGGCGTGGACATCTTGAGTGTGTAAGTTTCTGTTGAAGGTCATCAATCTCTGCTTTCAACATGCT
TAAATCTCAAATGTTGTTTATCTTATCTCTCCCGACTCAGCTCCTGCTTGAGTGAAGCAGCCTTTGCACAAAATTCTTTCCTGACAGCAAGGAGCTTCTT
GATTTCACCAGAGATGCACAACCTCATCTAAAATGTTTTCAATCACTGAAACCTATCTACCCAAATATGAATCTTTCAGACTTGAATCANACAGGGACAA
ACGGGAACTTGTTGATGAGCTTATTTGTTCATGGAGATGAACAAGAAGCAAACATGGAGAATAAAGGCATGAGCCTGTGTAATTCCNTTNGTCAGTCTGC
TC
page-top