Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig38  (registered. 2003)
Contig Information
Length 534 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Homology (BLAST) Top Hit Os01g0506200 [Oryza sativa (japonica cultivar-group)] >gi|113532680|dbj|BAF05063.1| Os01g0506200 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 678
Evalue 2.01584e-69
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig38
TCATATATAGGGTGGCAGATCATAGACAAGACATATATAGGTGGCAGACCATATACAGTCATTTCAAGAGACATACATAACATGGATGCTGGAANAGAAC
TGATATCTGTTTCTTCTCCGTCAAAACAAGATGCATCTCTTCTTCAACTCCTTCNCTTCTGCACATCTTGCTTGTGAACTCCCTTAGCAGTAGCAGCAGG
CTCATGTCCTTGTAGAATGGGCAGACTCTGAACAGTAACAAGATGTCCATCATACTTTACTATTTCAGGACCAGCTTCTTGTTTCTAGTTATCTTGCACC
ATTGGGGGTCCTCTAGTCTAGGCTTGATTTGTGTAGAGAGATCCTTGAGCAGATTCTTGTCCAGCGAGGAGGCCGCGGAATTAGCGTGGGCGTTGGCGAG
GAGNTCGTACAGCTCCTCCTTCTTCTGCTCAACTANCTCTGCACGGTGTTTCTCCTTCNAGGATTTCNAAAGCTCGAGGTACACCTGGTCCCTCTGCTGG
ATTATAGGCGGACAGTGTTCCTCCTCCANGGCGA
page-top