Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig36  (registered. 2003)
Contig Information
Length 690 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Homology (BLAST) Top Hit hypothetical protein LOC100192888 [Zea mays] >gi|194691818|gb|ACF79993.1| unknown [Zea mays]
Score 364
Evalue 4.60559e-33
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig36
GCAAACCGAAATATAATGGTAGCACTCGAGCCTCACCAAAGTAGCAGGCCAGACTATATGCAAACTACAACTACTAAGAGCAATTGGTTCGGCAACACAT
CCAGCGCGCAGCAAGGGATCTAAGTAAGGTCTATCCTATTACAGAATGACATCCTCACGCAGGAGGGAGAGATCATCCAGTGTGCGCCTTGAGCATGAGT
CCATCTAGTCCCTTATTCGCACCAGCCTTGGTGCCTCCTCCCATGCAATGTGCAGGAGACAGCGCCGCAGTAGCACTGATTGATCCCCGACGCATAAGGT
TTTCCACTGATGCAATTGAGCACACGCTCTCCCCAGGATCACCCGAATGCTTGTCCACGACACGCCCAGATCTCCTAGTTCCCGTCCTCATGATCGTCAT
GCTGGTATGTAGCGCCACCGTTTGGTATAGCACCTGCTCCTTTCACACTGATGTCACTGAAAGGCCTCTTCCTTGAGGAAGACGATGGTTCAGAGGCATC
CATTTCCATATCCTTCTGATCCTCCTCTACAGCCATGTTTGTCTGTTTCTCTTGAGGAGCACCGGATGTTGAAGCTGGAGGTGGCATCACATCAATTCCG
CTGAGCCGGCAGAAGACTTTCTCAACTGTCTCGGTGATCTCTTTCCCTAGTCCACCATTGTCGAGTATCAGCTCCCAAACTGCCTTTGAG
page-top