Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig35  (registered. 2003)
Contig Information
Length 697 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit hypothetical protein OsJ_002759 [Oryza sativa (japonica cultivar-group)]
Score 103
Evalue 0.00860239
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig35
AAACTTCAATTCCGTCATCTCGACAAATCACAAACAACATGATATGACAAATCACAAAAGGCTTGGGCTACGGCTGCAGTCGCGGTATAGTTCTCTTCCT
GACGAGAACAGCAGATGTACATGGCTACTCACATACTGCTCGTCGTCTTTTGAGCACTACATTTAACAAATTACAGTGGGACAAAGGAATCAGCACACAT
AAAAAAATGGCACACTGCTATGAGAACTGAATCAGAAATATTTTTATACAGCAGAAATACTGGGTGGAGGTGATGGCGACGCCTCTGTTGAAGGTGGTTT
ATCTTGTGTCTCTGGTTCCTTGGTAGAAGGTGCATCATTTGTAGAATCACTGGGAGTAACAGCAAGTGCATCAGTGCCACTGGAATCAGCTGCTGGAGCA
GGAGCTGGAGCTGGAGCATCAGCAGCGTCAGGACTGCTACTTGTTGGGTCTGGAACCGGAGCTTCTGTAGCTTCCGCAGTACCAGGGGCTGCAGTAGCTT
CGGCATTGCTGGTAGCTGCTGTAGCCTCCACATTGTCAGGAGCTGTTGTAGCCTCCGATGGCTTTACCTCATCGGTGCTTTGTGCCGGAGCAGGAGGGGC
TTGAGCCATGGGGGCACCTTGANCCACGGGAGTACCTTGGGCCATTGGGGTGCTGNGATTCNTGGNAGTACCTTGANCCATTGGGGNGCCTTGATTC
page-top