Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig27  (registered. 2003)
Contig Information
Length 679 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Homology (BLAST) Top Hit hypothetical protein OsI_05650 [Oryza sativa Indica Group]
Score 793
Evalue 8.02654e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig27
CCGCTCCCTTCGCCGCCGGGTCCAATCCAGCCGCGCCCGTGGAAACCTACCTAGGGTTTCGCCCTCGCCGCCCTCCAAAGGTTTTTGGAGAAGGGCTGTT
TGTACAGCGACATGAGGCCAATTTTCTGCGGGAACCTTGAATATGATGCCCGCCAGTCTGAAATCGAGCGTCTTTTCGGCAAATATGGAAGAGTGGAGCG
AGTTGACATGAAGACAGGATTTGCGTTTGTCTACATGGAAGATGAACGTGATGCTGAAGATGCTATCCATAGACTTGACAGAACTGACTTTGGTAGAAAA
GCGAGGAGACTGAGAGTCGAATGGACAAAGGAGGATCGCAGTGGTGGTCGGAAAGGAAATGGGAAGAGATCTCCAAGCAGCGTGAAACCAACCAAAACCT
TGTTTGTGATTAACTTTGATCCGATCAACACAAGGACAAGAGATCTGGAGAAGCACTTTGATCTGTATGGCAAGATTGTAAATATCAGAATCAGAAGGAA
CTTTGCATTTGTCCAGTATGAAACACAGGAGGATGCTACTAAAGCTCTGGACGGTACCAATGGAAGCACTGTGATGGACAGGGTCATCTCTGTTGAGTAT
GCACTTCGTGACGATGATGAAAAAAGGAACGGGTACAGTCCANACAGGAGAGGAGGCCGTGATANATCTCCTGACANAA
page-top