Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig26  (registered. 2003)
Contig Information
Length 656 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Homology (BLAST) Top Hit Os04g0298600 [Oryza sativa (japonica cultivar-group)] >gi|113563974|dbj|BAF14317.1| Os04g0298600 [Oryza sativa (japonica cultivar-group)]
Score 735
Evalue 3.91043e-76
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig26
GCTCGATGCATTAGTCACCCTTTTCAGCAGGGCTAATATACCAGCAGATGTTCGCGTAGTTGGTGGCTGGCTTTTTAGGCAACTGCTGCCCCATGGAGAG
GACGAGTTTACTGCTTTTCATCTAAAATTACTAAAGGATTCACACAAGGATTGCAGTGAAAAGCTGCTGGAAGAATCTGGAGGATGCTGGTGTGACTTGC
TTCTTCCTATCGTTAGAGAAGCTTGGAAAAATTGCAAGAAAGTTAGCAATTGAGGCATCTTCACCACCCAAAGGATCCAAGTCTATTATTTCACCTTTGG
AGCCGTCTTTATTTGGAGGTGATTCTTCTATCGCTATCGCGGAGAGAATCTATGAGATGGTTAAGTCGATCTGCCTGTAAATAAGCGAGCAACTGCAGCA
GGCTTCGATGGTTCAGTGCCCAAGCCTGGGCTTGAAGTCAACTTAGTTGATGCAATTCCTTGCCGGATAGCATTTGAAAGGGGCAAAGAACGTCACTTCA
GCTTTTTAGCTCTATCTAATGGAACTTCTGGGTGGATTCTCCTTTTANAAGAATTACCACAACAACGTGGAATTGTTCGTGTCACTGCCCCCTTGGCTGG
ATCTGATCCAAGAATANATGAAAAGCATGTGAANTGGNTGCATTTAAATATTCNNC
page-top