Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22  (registered. 2003)
Contig Information
Length 666 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit glutathione transferase [Triticum aestivum]
Score 691
Evalue 5.11534e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22
AAATGGAATGGCAGGTGGCAACTCGGTGCTGCCCCCACCGAAGACCAGGGTTGACACATTGACACACACACACATCACGAGTACTGAGTACACAACACGC
ACCCACACACACTGACTGATCCAACCAACAACCACCAACCACACACACACGGAGCACTTTATTCCACGAAGAAAGAAAGAAAGAAATACTCTATCCAGAC
GTACGCATTGTAGGCCACCCAAATCGCTCCCTGATTTATTTGTTGCTTCCCTCCGGACGGCGCGCCTACTCGATGCCGTACTTCTTCTTGAGCAGGCCGA
TGAAGTCGTAGACCTTGTCCGGCGAGTAGAGGCTCTTGGCGACGCTCTCCCGCTCGCCGCAGCGCTTGGCCCACGCGGCGATCTTGGGCGCCACCTCCGG
CAGGCTGAACTCGCCGTACCTCTCGTAGCTGTGGAACCAGGCGGTGAAGGGCGCGAAGGCGGCGTCGACGAACCCGAATTTCTCACCGCCGAAGAAGGGC
TTGTCCCCGAGCGCGCCGTCGAGGGTCTTGAGGATGTCCAGCATCTCGGCGCGCGCCTGCGCCTGCGGCTCGCCCTTGAGCTTCCAGAGGCGGGAGCCGC
AGTCGTANACCTTCTTGTCGACGTANTCGGCCCANAAGCGGGCCTGCNCGCGCGCGTANGGGTCGG
page-top