Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21  (registered. 2003)
Contig Information
Length 723 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit Os08g0497600 [Oryza sativa (japonica cultivar-group)] >gi|42407312|dbj|BAD08715.1| putative GAMYB-binding protein [Oryza sativa Japonica Group] >gi|113624109|dbj|BAF24054.1| Os08g0497600 [Oryza sativa (japonica cultivar-group)] >gi|215767295|dbj|BAG99523.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201387|gb|EEC83814.1| hypothetical protein OsI_29748 [Oryza sativa Indica Group]
Score 807
Evalue 2.17884e-84
Total Hit Count 87
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21
AGCTCGACAGCGATTCAAGCCCGTTCCTAACCCAAGGCGCCGAAATTAACCGAGGCCATGTCGCAGTACGACGGCGGACTCGCCGGAGTGTACCCCGAGG
AGGAGGATGACCGCCTCGCCGACCTGGCGGGGGACTCCGACTACGAGGACGACGAGTACGTCCAATCTATTAGCAAGGCGTCAGAAGATACATCTGCGAT
GGATGTCCTGAAAGGGAAGGACATACAGGGAATTCCCTGGGAACGGCTGACCATCACAAGGGACGGATATAGGAAGTCCAGACTGGAAGGGTATGCGAAC
TTTGAGAACATACCTAATTCCGGACAATTATCGGAGAAGCTATGTACACCTGTGGAGAAAGGTCAACTCTACTACGAGTTTGCGCATAACACAAGATCGG
TGAGACCGACCATTTTTCATTTTCAGAAGCATGAGGGGAATTTCTATGAGGGCTTTTATCGGACTCACGTTAGCACATTGGCAGTGAAGAATAACCTGCT
GGTTGCTGGTGGGTTTCAGGGAGAACTAATTTGCAAGTTTTTGGACCGTGAAGGAATAAGCTATTGTTCCAAGTCAACTCATGATGACAATGGCATTACT
AATTGTCTGGAGATATTTGAGAAACCTAGTGGTTCCGTGCATTTTCTAGCATCAAACAATGATTGTGGACTAAGAGACTTTGACATGGAGAAGTTTCAAA
TGTGCAATCATTTTCATTTCGAT
page-top