Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20  (registered. 2003)
Contig Information
Length 708 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Homology (BLAST) Top Hit PREDICTED: laminin, gamma 1 (formerly LAMB2) [Gallus gallus]
Score 80
Evalue 4.11466
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20
AGCAACCACAGCATCGTTACAAATAAACTGCATTTTTTACATAGCGAGCAAACCACAAAAAACTGGGAATTTTGCACAATATCCTGCGCAAACAGAAGCG
AACAGCCTGCGATCACCGTCCTATAGAGCAGAGCATGCTGGATGAGCTGAAAAAGATGCAAAGATTTCATCCATAGACTAGCCTCGCCACACACTTCTTA
TCCTTCCACCACCGTATGTGCCTTTTCCCTTTTATTTCTTCTTTGTGCGCACAAACAAGCTACAGCAGCAATATTCGACGGTAAAATCAGAGGAGAAAAA
AGCTAAACAGTAGATACTTCATGGGACAATAGTAGTTGCTTCAAAAGTCTGCAGCGGTGAGGAATCAATTCAGAGAGGAAAAAACTAACACTTGGTCACA
GGATGGAGGCAAACCTGCAGTCGGGAGCAGAAGCTATGATGTTTAGAGATAGCAGCTAGCGGCGGAGCAAGCGGAGGCCACGAGCAATGGATCAAACGAC
CTCCTTGGGACACCGCCACCTGCTGCTATGCTCCCGTAGCTACTGCCGCTCGCGGGACTGAGATGGATTCAGTGTGTGCAGGCGGCCGAATCGTTCAGAG
CTGCATGCCCGCTCGCTCTGAGCTGCAAGACACACACACCGCACGACGCCNCCCACGAAATCAAACTGCATCGGGAGCCTCGACTGTCTTCAGGCCAGCT
CACAGGAG
page-top