Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17  (registered. 2003)
Contig Information
Length 569 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195659551|gb|ACG49243.1| AKIN gamma [Zea mays]
Score 357
Evalue 1.89573e-32
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17
CACCTTACCGTGTTGGATTTCATGAAGGCTCTAGGTTCCACTCTTCCTGACTCGGGGGACAATGGGCTGGTGAAGCCGCCACTCACCTGTGCACCTGATG
CTTCCATGGGCAGCGTGATCGACAGCATCGGGTCGAGGATAACCCACCGGATATACGTGGTGGATGGCGACTTTGAGGTGGTCGGTGTTGTGACACTGCG
AGATGTGATCTCTTGCTTCATCCACGAGCCCCCTGGCTTCTGCGACAGTTATCTTGCTTCAGCGATGGAGAAGCTCGAGGACAAGGGCGATGCCGATTCC
TCCGTTGAGAACAGCTGAGCCCTCCGTTGAGAACAGCTGAGCTCTCGGGAGCGCAAGACGGTGGAAATAACAGACAGGTGCCTCTGTTGGTGTCAACTGT
GCGTTGCTGAGTTGGCTGATCCGCACCTGTTTCCTGATGCAAACACTGCAGTGGCGATTCTGTGATGTGTANAAGGGTTAACNAACCAATGATTACCCAA
TCTCANTCGTCATGTGTACCTTTGTATCCTCCTCNATCAATCNAGTANTCTGATGTATGGCAGNTGTTT
page-top