Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15  (registered. 2003)
Contig Information
Length 728 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Homology (BLAST) Top Hit hypothetical protein OsI_29906 [Oryza sativa Indica Group]
Score 459
Evalue 4.95521e-44
Total Hit Count 102
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15
ACACCGGTATATCGTATAATTAGGATGCCGGTGAGCAAGAACAAAAACTAGCAAGCACGATGCAAACAAACTCAAGCGTATTAACAAAGTTACAATAAAC
AATTAACAAACGCCGAGGTTTAAGCCCATATTAAACCTCGGCAAGATGCAGATACATAAGGCCGCTGCTGAAACTATAGTCCATACAATAGGGGGCAAAA
GGAAAACGAAAAAATCTGGTGGTGTACAGCGTTCCATCCTTCTACCATGGACAAGAGAGCACAGCCTCATCAGGGAAGAGCATGCTCTGATTTCTGCAAC
CCTACATGGCAGCCGACGATGGTTTACTTCTCAGCATGTCGGCGCTTGTGTCTCCTATTGCCATTGTTTCCGTTACCATTACGAGGCGATCTCTTCTGCT
TCTTCATGCTGTCGATGGTATGTAGTCGCAGACTCGAGAAATGTTCCATACACATGAACTGCTCTTTTAGTATAAGGCTTAAGAGTACTCCTAACTTTCT
CAACATGTGGCTTCGTGACCTCAGCAACTTGATCAATGTAAGGTTTAGAGATCTTCTTAGCTTCCTGGAAGTAGGGATCAGAAACTTCTTTAAATTTTAC
AAAGTGGGGTGTAATAGCATCCCTGGATGCTTCATAAACTTCCACTGATTTTGCCGACGCCTTCTCCACGTAAGGTTCTGCGTTTTTCTTTANCACAGCC
AGTTTCTCCTTAACAGGAACCAATTTCA
page-top