Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13  (registered. 2003)
Contig Information
Length 893 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Homology (BLAST) Top Hit Os07g0515700 [Oryza sativa (japonica cultivar-group)] >gi|113611313|dbj|BAF21691.1| Os07g0515700 [Oryza sativa (japonica cultivar-group)]
Score 293
Evalue 9.72969e-54
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13
TGTGGTGCATGTTCAGAAAACTTGGGGGAGGAAGACAAACTCCTGACATACCTTTCTACTCTACTTTAGCACCTTCAAGAGCCTGAATGCACCAGTAGCA
GCAGTGACAAAGCACCTTCTGGGTTGATTATTGCTTGTAAGTGGCGAGGTTCGACCAAGTTTATGATTTGGAGTTGTTGTAGATCCATTGGCTATTGAGT
TACTCAGAGAGACATGGAGTTGTCCATGGTTAACACGAGACCTAGGATCTGAGCTTGCATGGGCTGGATACACCTTCAAAGGAACCCCAGCTTGTAACAC
TGATCTCCAATATGGGAAAAAGCTTCTCTTTGTATACTTGGGATCCCATCCTCCGCCTACTTTCTTTCTCACAGCCTGTGTTTGTGTAGTGTGCTGTTGT
GCCATAAGGGAGAGGCCGTCATTTCCAACAGTTGTGACCTTCTTCTCTGCAGCATTCAGCTTGGCTGATTCCATAACTGCCATGTTTGCATCTGTAAGCC
AGGTTTATAGTGTCCATAAGATCTCCAGTAGGGCAAAATCCACACTCCTTGAGAATAGATGAAACATGTTGAAAGACCTCCACATGGGACACCACAGAAT
GCGCTTGAATGTATGCAGAAAGATCTTCACCGGCATGGGAAATTACATCAACAAGCAGCCATGCACAATCGTTAAGCGTCTTCCTTTCCTCCAGAAGCTC
CTGTGCCATTCCAAGTGAACCTTTCTCGTTTCTCAAGGCATATGAATGCCTCGTTATACACTTCTCGATGATTTCAAACCCATTTTTCTTACTACTGCCA
TTTATCTTGGAAGAACTAACCCCACGGGATCTGCTCTTGAGCAGCCAGTAGTAGAACAGCAGACTGGATAATTTTTTCCATCCTCAATATAAT
page-top