Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig12  (registered. 2003)
Contig Information
Length 642 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Homology (BLAST) Top Hit Os05g0562200 [Oryza sativa (japonica cultivar-group)] >gi|75117002|sp|Q688X9|DI191_ORYSJ Protein DEHYDRATION-INDUCED 19 (OsDi19) >gi|51854269|gb|AAU10650.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579870|dbj|BAF18233.1| Os05g0562200 [Oryza sativa (japonica cultivar-group)] >gi|215692680|dbj|BAG88100.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215766590|dbj|BAG98749.1| unnamed protein product [Oryza sativa Japonica Group]
Score 470
Evalue 2.00701e-45
Total Hit Count 76
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig12
CCGCGCGCGCGAGAGAGAAGCTCCCGGCTCGCCTCCTCCTCCCTCCCCTGTCTCCTCTCCCGGCTCCATCCATCCAGCGGGAGGAGAGGGCAGGCGGAGG
AGGGACGACCGCCGCAGGCCAGAGGCCGTACCTACCTACCTACCTATCTATCTATCTATCTAAGCCGCCGGAATGGACTCGGAGCACTGGATCTCGCGCC
TGGCCGCCGCCAAGCGATTCTACGCGGCGCAGCTCGGCCACGCCGCCTTGCCCTATCTGCTCCGAAAAGGTTTCTAAAGACATGCTTAACCATATCACCA
TGCAACATGGGTACTTGTTCAAGAATCGCCGCAGGTTGCGCAGATTTGCTGTTCCAGGCAGCCAGTCGCTCTCTCTGCTGAGCCGGGATCTACGTGAAGC
CCATTTGCAGGTGCTTCTGGGAGGTGGTGGACATAGGTCGAGCAACAATAATGCCACAAATATTTCAGCTGATCCTCTTCTGTCATCATTTGGCCTTAGC
TTCCCAACATTANATGCTGAGGAAACATCAAAATTGTCTACTCCTGCTCANAGTGATGTACCAGTGCTAAAAGAGACAGCTGCTCGGCCGTGGCGGTCAA
GTATTGACTCNTCGCTCACAAGGGAANAAAGGGAGCAAGCCA
page-top