Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9  (registered. 2003)
Contig Information
Length 774 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 157
Evalue 5.84748e-09
Total Hit Count 216
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9
CAACACGGAACATAGTTTTCTGAGGGGGCAAAAGAATTTTCTGATTGTTTATTAACCCCCTCCTTAAAAAAATCTTCACATATTGCTAGTGCATTACACT
GTAGCACACAGCTTTTACGATCGCCTCCCAAGTCCCCAAGCTGTAATTCCTCGGACAATCCAGATGTTGTCCACACCACAGAGTACAACAGCAGCCAACT
TGGATCTGAAGGGGTTCCACACCCAGTACTCAACCTTGGATCCGTCCTCGTTCATGTGCTATCGAATTTCAATTCTGTAGCAGTGGAATTCTGGACAGTG
TTTCAGGAATCTGTACAATAATGTCAAAGGGAAGGTAATTTAAGATGGCATCCAATTAGTTCAGTAGTGCTTAAAAAATCTAATTAGTTTAGGAAGACAA
CAAAACTTTAATAATAAGTACATGTATAGTTCAACATTAAAAGATGAGCAAGTGGAAAGAAACTGACACTAAGAATGGAATATTAACAGGAACATAACTC
CGACTGAACTTGTTCAATTTTTTTTACAGTTCCATGAATGCAGAACCAGGGCACATTGTTCAAACAGTTTTGGTTAAAACATTTTTTCAGACAGTCAATA
ATTTCAGCTTGTAAATCCCCAAAATTTCTCGAAAAAAAACCATAATAAATAAACATGAACATGCTCTTATTTGTTGTTCCAACATCAAGAAATAAAGATT
GGGCGCGTATTGGCTGCATCTCTGTCGGGCATCGTGGCCTCGTATTGGATATCTTTGCTTCTATATTTTCAATC
page-top