Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6  (registered. 2003)
Contig Information
Length 692 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit hypothetical protein OsJ_024759 [Oryza sativa (japonica cultivar-group)]
Score 478
Evalue 2.80928e-46
Total Hit Count 200
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6
TATGATCTCTCTCTCCCCCCTCGCCTTCCTCGGTCTCATTCTCTCCCTGTCCAAATATCCATCCAGGACAGCGCCCCTCTGATCCGCCCTCCTCCCCTCG
CGAGGCGGCCACGCCATTTTTATCCAGTTCTTGATCCGTGATCCTCCCCGCCGCCCCTTGCCAAGAAGCCGCCGCCGGTCGCCGGAGAGGAGGGCCGGCC
TGAATCGCTGCCGGATTCCGTTCTTGTGGGCTGGATCCTGTCGGAGAGTGCCCCGGTTCTTGCGGTTCGGAATTGGGGCGAGTTGTCCGTACGAAGGGTG
AAGCTGTCGCTTCGGCCTTCGGGGGCTTTTGATGAATTCTCGCCGATCCAGGTCTGTGAAGCTACTGTCGTCGCGCGCCAAGCCCCTGGAGGTTGACGTT
GCAGAGGAGGACCCGCGGATGAGCTCGTCGGCCGACAACACGGTGTACTGCTGCATTGCCAAGGGGAACAAGGTCATATACAGCTACAGCAGCAAGGATG
GTGACTCGCAGACCGAGGCCACGGCGGCGCTCTGCCTCGAGAACGTGCCTCCCTACCACCGGCATTACATCCACACTTCGGGGTCGAGGAGCTACGGCTA
TCTGATGGCAGACGGGCACACCTTTTTCGCAATCATCGACCCGAGCGTCGGGAATGTGGGTGCCTTGCANTTCCTGGAGCGTGTGCGGGATG
page-top