Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig2  (registered. 2003)
Contig Information
Length 681 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit env polyprotein - simian immunodeficiency virus SIVagm (isolate SAB-2) (fragment) >gi|466212|gb|AAA21495.1| envelope protein
Score 80
Evalue 3.81596
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig2
CTCTTCTTGGAATAATGGCGGCTGTAGCATCTTTCACTGCCTTGCCTCCTCCACCACTCCTCTCCCTTCTTCCTCCATCTTCCTCCTCTACGTCCTCCCC
TCCCTGCCACGAAACTCTCCCCCTCTCCCGCCTCCCTCTTCTAACAATTCTCCCTGTCGCCGCAGGTTTTGCCACCAGGACTCCATGAGGAGATTGCGGC
CGCGGGGTGTCCAGCCAGGGTGAGCACAACAACAACACCGGCAGTGCCGCGCTGGGCCATGTAGGGAGAGCCTATTCGCACCGTGACAGATGGAGTAGTT
TCCACTGATGTCCCTCCTCCTTTCCTCGATTTAATTGTCAGATGCATTGATCAACAGAATCGGTGTGAGACTATTAAGAAAACGAACCCGGCTGGATATA
TGTATCTCAGTTGGAAGGTGCCTCTCTGCCAGATCAGGAAGAATGCCGGCAGCTGGAATTCTCAGCTAGAAAAGGATTAAATATTAGAGACCTATTCTGC
ACAACTCCAACGAGAACTACCATGGTGTTGTTTTTGTGCAGAAATAAAAGTTCTCGGAATGGAACAAAACTTTGCAAGGATTTTTTATATCAATAAAGAG
AATTTTTGAAGACAAGAGTCACCTGAGGGGGGCACCTGGTTGGGCACAACACACTANGGCGCGCCTGCCGCCCCCCCCCCC
page-top