Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1  (registered. 2003)
Contig Information
Length 804 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Homology (BLAST) Top Hit Phage protein [Ralstonia solanacearum UW551] >gi|207743990|ref|YP_002260382.1| phage uncharacterized protein, c-terminal [Ralstonia solanacearum IPO1609] >gi|83725622|gb|EAP72765.1| Phage protein [Ralstonia solanacearum UW551] >gi|206595392|emb|CAQ62319.1| putative phage uncharacterized protein, c-terminal [Ralstonia solanacearum IPO1609]
Score 86
Evalue 1.05821
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1
TTCTTTTGTTCAACTAAGCTAAACAATTGGTTTGAGCTTGACACGCAGCTACAGCCATGTCTAGGAAGACAAATTGTTTGTTTGGAACCTTCTTATTGGA
TGACTTCATTAGATGTCTTGTGAATAACAGACTCGCCACCATCATGTGAAACAGCATAATTTAAACAGGACCACATGTCTCCCGCAGAAGAATCACCAAG
CTTGCAATGCTTTTGAAGATCAGAGCTTAACCTTGCGCCACAAGATTTTGTTGCTGAATCATTGGAGGAGAAAAGTAGAGATTGAACTGTCCAATTCCAA
ACATCTCGGGCTTCAATGGTCCTTGCTGTCCTCGATTCCCTGTTTGAGCAAACTGTACACAAGGAGAAGACCAATCAGGGAGCCAAAATTAAACAAACTA
CAAAAGGATAAAATGGAAAATGGACTGAAAAAATATTAGATCATTTTGAGGTGGCGTCCATCCTGGTTGCAAAGCAAATGGGGCTGATGAGGTTCTGCCA
GCCTGCCCCTGCTGCTGCTCACTGAATTGGTCGGACTACTTATAGGCAGTGTGCTTCCTCGGGTATTCTGTCTCGCTTCTAGCTTCATTCTCCGCCTTGG
TCTTTGTGCGTTGGCTAGCTGCTCTTCCGGTAGCTCCGAGCAGACAGCCACTCAAAAACTTCTTCACTTGTGAACGTTAGTGCAGGCCATGCCACAGCTC
GCAAATGTCACTCCATATTTATCCAGATTGTACAAGACCTGATTGCTAGGTAATTCCGCATATCCATTTTANACAATGCAATGCCTGCANACTGCCGGCA
TCTT
page-top