Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16284  (registered. 2002)
Contig Information
Length 3512 bp
Clones 208 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 29
Wh_SL Seed DPA30 18
Wh_dL Crown of seedling 18
Wh_e Seed DPA10 11
Wh_f Spike at flowering date 22
Wh_h Spike at heading date 23
Wh_oh Pistil at heading date 1
Wh_r Root 38
Wh_yd Spikelet at late flowering 23
Wh_yf Spikelet at early flowering 25
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Aurantimonas sp. SI85-9A1] >gi|90336396|gb|EAS50137.1| conserved hypothetical protein [Aurantimonas sp. SI85-9A1]
Score 404
Evalue 1.91498e-43
Total Hit Count 292
Registered year 2002
Contig Sequence     [ Download ]
>Contig16284
aggaattcggcacgaggcgggcattgaG*AAGGAAGGACGCTTTCAG*AGGCGAAAGGCCATGGGGAGAGATTTTTCTGTGATCCATGGATCTCCGATCG
GGAAACCGTATCCAAGCTCCGTGGCTAGTCTGCGCTCTTTGGACTTTTCAAACTTAGCGAACTGAAACATCTGAGTAGCTAAAGGAAGGAAAATCAACCG
AGACCCCGTTAGTAGCGGCGAGCGAGAGCGGAACAAGGGTTTTCATCAAAA*GAAATCCGAAGCGGTTTCATTCGATTTGTTGTGGATTGGATGATGGAA
AAACCAGCAAGCAGCAAGCGTAGTTAGAAAAGTTGCCGTAGCGCGCCCTACGGAGTTGTACAAAGTCAGCAACC*GTTTTGGGGCGCAAGCATAGGCAAC
ACAGGACTGATGACGGGGTGGGGCGCGCAGTGAACTGGTTTTCTAAAAAG*ATTGGAAGATCCGGCCAAAGAAGGTGATAGCCCTGTTCATTCGTT*CCC
ATGGTTCGATCCTTCCCAGTAAAACGCGGCGTGTTCGAATGATGATCGCTTTTACGCGAGAAA*GGGGGACCACCCTCTAAGCCTAAGTATTCCTCAATG
ACCGATAGCGTACAAGTACCGTGAGGGGAAAGGTGAAAAGAACCCCAATCGGGG*AGTGCAATAGAGAACCTGAGATCCGATGCGAACAATCAGTCGAAG
GAGCGGAGCGCGGGCGCACTCACTCTAACGGCGTACCTTTCGCATGATGGGTCAGCGAGG*AAATGGGAACAGCGGCTTAAGCCATTAGGTGTAGGCGCT
TTCCAGAGGTGGAAGATTTACGTTCTTCCTATTTGACCCGAAACCGATCGATCTAGCCATGAGCAGGTTGAAGAGAGCTCTAACAGGCCTTGGAGGACCG
AACCCACGTATGTGGCAAAATACGGGGATGACTTGTGGCTAGGGGTGAAAG*GCCAACCAAGATCGGATATAGCTGGTTTTCCGCGAAATCTATTTCA*G
TAGAGCGTATGATGTCGATGGCCC*GAGGTAGAGCACTCAATGGGCTAGGGTGGCCCCCATTTCGCTTTACCAACCCCAGGG*AAACTCCGAATACAGGC
CGTCATCCTTAGTACAGACAGACTGATTGGGTGCTAAGATCCAAAGTCGAGAGGGAAACAGCCCAGATCGTACGCTAAGGTCCCTAAGCAATCACTTAGT
GGAAAAGGAAGTG*ATCGAGCGATGACAACCAGGAGGTGGGCTTGGAAGCAGCCATCCTTTGAAGAAAGCGTAATAGCTCACTGGTCTAGCTCCATGGCA
CCGAAAATGTCTCAGGGCTCAAGTGATTCACCGAAGCGACGAGACC*TTGAAAGCAGCTTTTTCAAGTGTCAGTAG*CGGG*ACGTTCTGTCAATCGGGG
*AAGGTTTTTGGTGACAA*GACCTGG*AGATATCAGAAGTGAGAATGCTGACATGAGTAACGAGAAATCCTGTGAAAAACACGATCGCCTGCCAGTGGAA
GGCTTTCTGCGTTCAGTCAATCTACGCAGAGTGAATCGGTCCCTAAGGAACCCCCGAAAGGGCTGCCGT*CCG*ATGGGTACACGAAAGTGACGAAGTTG
CTTTGACTACTGAACCATGCCTGGATCGTCGGAGCGAATTGGATGATCGGGCCGAGGGCTGCCCCCTCTTCCCCTCGCTCTCCTTTCCTTAATATTCACC
GTCG*AGTCATCAAAGCCGTCAACTAATTCAGAGGGGCTCGGCTGGCCCGGTCGCCCTACGCTACTGGCGCTTCCAAAGGCGAAGCTCTCGTCTTTGGCG
ACCAGCAAACGG*AGGGCTAAAACCTGTAGTTTTGAAGCAAGGGATGAGCGCGAAAGCCGTTGCGCTTCCGTACACGCGCATACGTTTTCTTGCTGGGGC
GGACACGG*ATTTCTCT*CTAAAGGCGAAGAAAAAGAAGTGGGCGAACACTCGGCCCAGCGGGCGAACATGCCGGCTCCGGCTCCGCGCACCTGCTGACA
CCTTTCGAAGCACTTTCACGTGTGAACCGAA*GTCGT*CTTGCCGAACTCCTTCCTTTCTCATTTCAGT*CCTCGCCTTTTTCATCTTCCGTAGGGGCCT
TTAGTCTTTTGATTAGAGTGGAGGTCGCGAGAGAGCAGAGCGTACCGCCCTGCCATAGTCGCGAGGATCTTAATAGTCGGTCGCGACTGTTGTCATAGTC
AACGACGG*TTGAAACTTC*CAGGAAAAAACTTCGAATTGGGAGGGCGATCCTCCCGGTGAACTGACCGTACCCCAAACCGACACAGGTGAACAAGTAGA
GTATACTAGGGCGCGTCGAGAGAACCATGTCGAAGGAACTCGGCAAAATGACCCCGTAACTTCGGG*AGAAGGGGTGCTCTCCTATCTTTTGATTAGGAA
AGCGGCACATACCAGGGGGTAGCGACTGTTTATTAAAAACACAGGACTCTGCTAAGTGGTAACACGATGTATAGAGTCTGACACCTGCCCGGTGCTGGAA
GGTCGGAAGGAGAAGTGTGATAAGCTTTGAATGGAAGCCCCGGTAAACGGCGGCAGTAACTCTAACTGTCCTAAGGTAGCGAAATTCCTTGTCGCATAAG
TAGCGACCTGCACGAATGGTGTAACGACTGCCCCGCTGTCTCCGACATGGACCCGGTGAAATTGAATTCTCCGTGAAGATGCGGAGTACCAACGGCTAGA
CGGTAAGACCCCGTGCACCTTGACTATAGCTTCGCAGTGACAACCTTGATCGAATGTGTAGGATAGGTGGGAGGTGGTGACACACAACGACCAATCCTGA
AAGACCACTCTTTCGTCTAAGGATGCCTAACCGCCGCACCGATCATTCGGGGGGGGCGGGACACTGCGAGGTGGGTAGTTTATCTGGGGCGG*ATGCCTC
CTAAAGAGTAACGGAGGTGTGCGAAGGTAGGCTCAAGCGTTGATTCTGCTCGTGAGCGTAATGGTATAAGCCTGCCTGACTGTGAGACCGACTGGTCGAA
CAGAGACGAAAGTCGGCCATAGTGATCCGGGAGTCCCGTGTGGAAGGGCTCTCGCTCAACGGATCAAAGGTACGCCGGGGATAACAGGCTGATGACTCCC
AAGAGCTCTTATCGACGGAGTCGTTTGGCACCTCGATGTCGACTCATCACATCCTGGGGTTGAAGAAGGTCCCAAGGGTTCGGTTGTTCGCCGATGAAA*
GTGGTACGTGAGTTGGGTTTAGAACGTCGTGAG*ACAGTTC*GGTTCCTATCTACCGTTGGTGTTAAAGGGAGAACTGCGAGGAGCCAGCCCTAGTACGA
GAGGACTGGGCTGGGTCAACCTATGGTGTACCGGTTGTTATGCCAATAGCAGCGCCGGGCAGCTAAGTTGGTATGGAAGAACTGCTGCGCCGCGGGAAAT
CCTTCTCTATACAAGTT*CTCGTACGAGGTTTTTGAACAGAACTTCGATAGGCGAGAGGTGTAAGCACCGCGAGGTGTGAAGCGATCTCGTACTAAAcga
ataaaaaaaaaa
page-top