Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16281  (registered. 2002)
Contig Information
Length 1336 bp
Clones 189 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 25
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 19
Wh_f Spike at flowering date 33
Wh_h Spike at heading date 58
Wh_oh Pistil at heading date 2
Wh_r Root 8
Wh_yd Spikelet at late flowering 14
Wh_yf Spikelet at early flowering 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017237 [Oryza sativa (japonica cultivar-group)]
Score 1736
Evalue 0
Total Hit Count 267
Registered year 2002
Contig Sequence     [ Download ]
>Contig16281
caagaaatactacaaacagggtacaggagaattcatGCTTTTATTTCT*AATGGTGCGACACGCTACGTATGGGACAGGCCAAATCACACATTTTTAAAC
AAATTTGATGCAAAATTAT*ACTCCTTGTGCCACTAACAAGAAACAGCAGTAACGACCTTAATTATGGCTTTTAGACTATTTGATAGTTCGCAGCAACCA
AACGGACCCTCTGTGAATACTTTGGAGGGTTGCCTTCCTTCAGAGGATGAATTCCAGTGACCTTCAAATCACTGAAAGTATTGGAAGCAGCAAATCCAAT
AGAGATGGGGAAAAATGTTGACGGGTCGGCCGGGGGAACAATAAATTCCATCGACCCACTGCGGTTTGACTGATCAATAAGGATGATGGACCATTCCAAT
GCAGAGTTTCTTGAGTCATACTTCCACTCTCCATCAATCTGTTTAACAGTTGGAGCCTCCCGAAGTGCAGGCAGAGGAATAGATATGACAACATTGTTCA
GGTCAAACATCTCTGAAGCCTCATATTCAATGTTGACATAGGTTTCATTTCCAGATACTGAGGGCCAGCAGTTAACTGACAGAGGTAAATCCGATTCATT
CATCCCCTGGATTCTCCATTTCACAAGTGGTGTTTCATTTTGACCACTTGGGAAAGGCCTGTTTGGATCTTTTGCTCCAACAATTTGCTGGCTGTTAAAC
AACT*CCTTGTGGATATTGGGG*TGTGTTTTGAAGCTGAGTCCAGGTACATCTTTGTTTTCGATCTGTAACTGGATAAATCCATCTGCATCATTAAGGAC
CTGAAGAGCAAGGGTTCCTTGCACATCAAAGTTATTAACACCTCCATCTCTTTtaactATTACATTAAGTTTCTCTTCAATAGTCACTGTGATGGGATCG
CTTGGTATAAGAGGCGAGGCCCTTGAAGAAACTGAACTTGGTTGTGCATCCTCCAAAATGACTTCTCCTTCAGCTTTCAAAGATTCTAGGAACTGATTTG
TCTTCTGTGATTTGCCTAATTTCATACCAAAACCTTTGCCAGGAGCAGTAGCAGCAGCTGACGGACGACCTTTGGGTTTACTCGCAAATGAGTCCATATC
AGCGCCTATTCCACTTAATCCAGAACCACTTCCAAAGCCAGTACCACTGATGTTCATGTCACTGAAAGTTTTTTCAATAACACGGGGACCAGATATTGAT
GAGTATCCTCCTTTGTCAAGTTTgcctttctccatcctgattttgtcaagctcactagctctcttcttcatgacatctttagtttcattgatcttgctct
gcatcatcagcttatgtgccttctcttcaggctttc
page-top