Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16278  (registered. 2002)
Contig Information
Length 1732 bp
Clones 175 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 43
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 16
Wh_e Seed DPA10 13
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 15
Wh_oh Pistil at heading date 7
Wh_r Root 16
Wh_yd Spikelet at late flowering 38
Wh_yf Spikelet at early flowering 18
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha tubulin-2A [Triticum aestivum] >gi|90289598|gb|ABD92931.1| alpha tubulin-2D [Triticum aestivum] >gi|90289600|gb|ABD92932.1| alpha tubulin-2B [Triticum aestivum]
Score 1432
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16278
ttttttttttaAGGCTATGGTGTAGATAACCAG*ATAGCATGCATATTAACCA*AGGTGCATAACAGG*TTCAAAG*A*TACAAGGGTCTTACAACACAA
CAGGTTGTAAAACAAACACCACAAAGCAAAGATTCAAACAG*ACAG*ATAACAG*ATAAAGCCACTCGGGCAG*ATCATGGGATA*GCAGCAGCACGCCT
TGCGAAAGCACCAGGAGGCAGGCTCTAGTACTCGTCGCCCTCGTCACCGTCCTCACCCTCGTCGAACTCAGCACCAACTTCTTCATAGTCCTTCTCCAGG
G*CAGC*AAGATCCTCACGGGCCTCAGAGAACTCTCCCTCCTCCATGC*CCTCACCGACGTACCAGTGGACGAAGG*CACGCTTGGCGTACATGAGGTCA
AACTTGTGGTCAATGCGGGAGAAGACCTCGACGACACTGGTGGAGTTGGAGATCATGCACACAGCCCTCTGGACCTTGGCAAGGTCACCACCTGGGACAA
CACCTGGTGGCTGGTAGTTGATACCACACTTGAAGCCAGTGGGGCACCAGTCAACAAACTGGATAGTGCGCTT*GGTCTTGATGGTGG*CCACAGCAGCG
TTGACATCCTTGGGAACAACATCACCACGG*T*ACATGAGACAGCAGGCCATGTACTT*GCCGTGGC*GGGGG*TCACACT*TGGCCATCATAGATGAAG
GCTCAAA*GGCGCT*G*TTGGTGATCTCAGCAACAGACAGCTGCTCATGGTAGGCCTTCTCAGCTGAGATCACTGGGGCATAGGAGGAAAGCATGAAGTG
GATCCT*CGGGTAGGGCACCAAGTTGGTCTGG*AA*TTCATTGACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCTGTCAGCGATGAAATGACC
TGAGAAACAAGCCTGTTGAGGTTGGTGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCATTGTCAAGAAGGATAGACA
CATCAGTGTGCTCAAGGAGGGAGTGGGTGGACAGGACACTGTTGTATGGCTCAACAACAGAGGTGGAGACCTGGGGTG*ATGGGTACACTGTGAACCCAA
GCTTGGACTTCTTTCCATAGTCAACAGAGAGGCGCTCCAGCAGAAGAGAACCAAGGGCCAGAGCCAGTTCCACCTCCAACAGCGTTGAAGACAAGGAATC
CCTGGAGACCAGTGCAGTTGTCTGAAAGCTTCCTGATACGGTCAAGGCACAGATCAACAAT*CTCCTTGCCAATGGTGTAATGACCACGGGCGAAGTTGT
TGGCTGCATCCTCCTTGCCACTGATAAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGCGCCAGTCCTCACCTCATCAATCACAGTGGGCTCG*AGATCTA
CGAAGACAGCACGGGGGACGTGCTTCCCAGCCCCAGT*CTCGCTGAAGAAGGTGTTGAAAGCATCATCACCTCCCCCAACGGTCTTGTCACCGGGCATCT
GGCCATCAGGCTGAATGCCATGCTCGAGGCAGTAGAGCTCCCAGCACGCGTTCCCGACCTGGATGCCGGCCTGGCCGATGTGGATCGAGATGCACTCCCT
CATGGCGGCGGGTGGGGGTGGTTGGTGGGTGCGCCGCTGGCGAAATGGGGAGGAGGTGGGCGGAAGG*CT*CGGTTGCGCGGAGAGAGGCGAGT*ACGAA
GACGCCTTTCCCTCGTGCCgaattncctgcag
page-top