Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16276  (registered. 2002)
Contig Information
Length 1934 bp
Clones 170 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 12
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 28
Wh_e Seed DPA10 17
Wh_f Spike at flowering date 34
Wh_h Spike at heading date 17
Wh_oh Pistil at heading date 12
Wh_r Root 18
Wh_yd Spikelet at late flowering 12
Wh_yf Spikelet at early flowering 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ADP/ATP carrier protein [Penicillium chrysogenum]
Score 1350
Evalue 1.00515e-146
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16276
ttttttttttaGGATGTTGACACCAATAGCATAAACTTGACCATAATATCAGT*CGGATTGGAGGACAATGTATTTAAGG*AAAATTGCCCGGTAACGAT
TCAGGGCACATACTCGAACTCAAACTCAACCC*TATGATAGTAAATGTTTTGAGAACGCTGCCGCCAACCTACGACAACC*TCTGGAGTTCGATGCCTCC
ACCAAAAACGAATGTTGGGAAAATCCACCCTCTACAATAATTATTGCCTTCCAACGTTAAAAAGATAAAAGTTCACCA*GAT*CCTCGAAGGGTAGGACT
GGGAACAAACTTCTCTTGTT*CGTCATCATTTCGTCCCCTCTAGGCACCGCCTGAGCCGTACTTCTTGCCGAAGAAGAGGATCTGGAGCTGATCATAGCC
*GGAGAGCACACCA*GCACCAGCAATGGCACGGAGG*ATGTTGGCACCAGCCCCCTTGAAGAGGGACTTGGCACCCTCCTTCTTCAGGATCTGCTGGAAA
GCATCCAAGGAGCTCTTGTACTTGACGGCCTCTCCGGAGGTCATCATCATCCTTCTGCGGACAGTGTCAATGGGGTAAGATGCAAGACCTGCACCA*TTG
GTGATCAACCAACCAAGAGCAAAGCTGGCAAAGAAGTTGTCCTGGAGAGTGCCAGTGAGGAGAACTGGCTTCAGAGAATCATAGAGTCCAAAGTACAGAC
CACGGTAGACAATGATTCCAACACAGG*A*GATGTTGAATCCACGGTAAAGCCCAGCAATACCATCTGACTT*GAGAGTCTTGCGGTAGACATCAACCAG
GCCATTGAATTGCCTTTCACCTCCACCCTTGGATGCCTTTGCGTCATTGGCCAGCCTTGTCCTAGCATAGTCAAGGGAGTACACAAAGAACAGCGAGGAA
GCACCAGCGG*CACCACCAGAAGCAAGGTTGCCACCAAACCACTTCCAGTAACCATCCTTGTCCTGG*AGAGTGCCAGTGAGGAGAACGGGCTTCAGAGA
ATCATACAGTCCAAAGTACAGACCACGGTAGACAATGATTCCAACACAAG*A*GATGTTGAATCCACGGTAAAGCCCAGCAATACCATCTGACTT*G*AG
AGTCTT*GCGGTAGACATCAACCAGGCCATTGAATTGCCTGTCACCTCCACCCTTGGATGCCTTTGCGTCATTGGCCAGCCTTGTCCTAGCATAGTCCAG
GGAGTACACGAAGAAGAGCGAGGAAGCACCAGCAGCACCACCAGAAGCAAGGTTGCCACCGAACCACTTCCAGTAACCATCCTTGTCCTTCTTGAAGTTG
AACATCC*T*CTTGAAGTAAT*CCTTGAATGCAAAGTTCAAAGCCTGAGTTGGGAAGTAACGGATGACGTTAGCAGTGTTTCCTCTCCACAATGAGCCAA
AGCCTTCATCCTTGATGGTGCGGCCAAAGCAGTCACCAATACCCTTGTATGGCTCAGAGAGCCTGCCAGCCTTGATCATCTCATCCTGGTTCTGGATAAG
CAGCTTAACACGCTCAATAGGAGCTGCAGCAGTCTTGGAAACTGCAGCGGACACTCCTCCCATGAGGAAGTCAATTGCAAAGTTCTTGACACCTTTCTTC
TCAGGTGGTGCATTGGCAAACAATGGAGAAGATGACATCATGGGGACACTGATGCCAAGGTTCTGAGTCATGTAGCAGCTTGTGGTGAAGCGCCTCTCAT
AGGATGGCACAGAAGGGCAGATGTTGCGAGCACGAACACCCTCAGAGAAGCTGGAGGCAAGGTGGAACTGTCCACCAAACTTCTGCATGACAGACGGGTG
GTTAGCACGGTCCGCCATCT*CTGACCCTTCGGAAGCGGAGGCGAGGAAGATGGGGTGGTGGCTCTT*CCCGGCTCGGCGGCTCCGCTCCTTCCGGT*CT
TGCGGTGAGAGAGAGAGAGGGgtacCAGGGGctc
page-top