Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16273  (registered. 2002)
Contig Information
Length 866 bp
Clones 162 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 29
Wh_SL Seed DPA30 43
Wh_dL Crown of seedling 18
Wh_e Seed DPA10 14
Wh_f Spike at flowering date 9
Wh_h Spike at heading date 12
Wh_oh Pistil at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 22
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Translationally-controlled tumor protein homolog; Short=TCTP >gi|21070379|gb|AAM34280.1|AF508970_1 translationally controlled tumor protein [Triticum aestivum]
Score 804
Evalue 6.29466e-84
Total Hit Count 335
Registered year 2002
Contig Sequence     [ Download ]
>Contig16273
ttttttttttgaCACAAGATAATCCGATAGAATAACAGGG*CAGAATCTCTTGATTCAACCAAAACACAAC*CACACCAATTT*CACGATTAC*CATTAC
AAAG*CAAATCCCACAATTAT*CAG*AAA*GTTTTCAAG*ACACTCAAC*ATCTGACAGTTACTGACACCAACATTGG*AG*AGTCGACTGACAACCATA
GATAAGAGCAAAAATACTGAAGACAGCATAGATTTTAGCATACAGTGCGATTAGCACTTGACCTCTTTCAGCCCATGTGCAAAGTACAGG*AAAGTTGGA
TCAGCAGC*TCCCTCCTTGTAGTAGGCGAACACCACGCCGCCATCATCATGCATGCTCTCGCCAACAAAGAACTGAAGGTCCTTGAGCTTGCTAAGAAGA
TACTTTGTGGCGGAC*TCAACATTCTT*CTTGAAAGCATCTAGG*TCATCCCCTTCAAGCTTGGCAGAGAGGTTCTTGATGTAGCGCTTCATGTGAGAGA
TAAACTGCTTCTTGTCAAAAGCAGGTTGCTCCTGAAGACGGAAGGTGTCAACAATGTCAACCACCTTCACGGCCTGGTCATCAACACCCTCATCATCACC
ACCACCCTCAGCAGAGGGATTGGCT*CCAATGTCCACATCAACTGCT*CCTTGAACGACCCAATGGCCATCGAC*TT*CCCAGAGCACGCCGTTCTCCAG
CT*CCCTGTAAGGGAACGAATCCGACAGAAGCTCGTCGCCGGAAA*GCTTGT*CCTGGTACACGAGC*ATGGTGCCGCCT*CTTGAGATTT*CT*CCCCC
G*AAAAAAG*AGAAAACCCTAACGAGC*T*CTGGGGGAGGCAGGGGAGTAGCGGccctcgtgccga
page-top