Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16272  (registered. 2002)
Contig Information
Length 1705 bp
Clones 157 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 37
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 19
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 19
Wh_oh Pistil at heading date 8
Wh_r Root 30
Wh_yd Spikelet at late flowering 14
Wh_yf Spikelet at early flowering 16
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha tubulin-2A [Triticum aestivum] >gi|90289598|gb|ABD92931.1| alpha tubulin-2D [Triticum aestivum] >gi|90289600|gb|ABD92932.1| alpha tubulin-2B [Triticum aestivum]
Score 1040
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16272
ttttttttttaGATAACCAGATAGCATGCATATTAACCAAGGTGCAAAG*CAGGTTCAAAG*ATACAAGGTTCTTACAACACAACAGGTTGTAAAACAAA
CACCACAA*AG*CAAACGTTCAAACAGACAG*ATAACAGATAAAGCCACTCGGGCAGATCATAGGATAGCAGTAGCAAGCCTTGGGAAAGCACCAGGAGG
CAGGCTTAATACT*CATCGCCCTCATCACCGTCCTCACCCTCGTCGAACTCAGCACCAACTTCTTCATAGTCCTTCTCCAGGGCAGCGAGATCCTCACGG
GCCTCAGAGAACTCTCCCTCCTCCATGCCCTCACCGACGTACCAGTGGACGAAGGCACGCTTGGCGTACATCAGGTCAAACTTGTGGTCGATGCGGGAGA
AGACCTCGACGACACTGGT*GGAGTTGGAGATCATGCACACAGCCCTCTGGACCTTGGCAAGGTCACCGCCTGGGACGACACC*TGGTGGCTGGTAGTTG
ATACCACACTTGAAGCCAGTGGGGCACCAGTCAACAAA*CTGAATAGTGCGCTTGGTCTTGATGGTGGCCACAG*CAGCGTT*GACGTCCTTTGGCACAA
CATCACCACGG*TACATGAGACA*GCAGGCCATGTACTT*GCCGTGGCGGGGGGTCGCACTTGGCCATCATGGACGAAGGCTCAAAGG*CGCT*G*TTGG
*TGATCTCAGCAACGGACAGCTGCTCATGGTAAGCCTTCTCAGCTGAGATCACTGGGGCATAGGAGGAAAGCATGAAGTGGATCCT*CGGGTAGGGCACC
AAG*TTGGTCTGGAATTCATTGACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCTGTCAGTGATGAAATGACCTGAGAAACAAGCCTGTTGAGG
TTGGTGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCATTGTCAAGAAGGATAGAGACATCAGTGTGCTCAAGGAGTG
AGTGGGTGGACAGGACACTGTTGTATGGCTCAACAACAGAGGTGGAGACCTGGGGAGATGGGTACACCGTGAACCCAAGCTTGGACTTCTTTCCATAGTC
AACAGAGAGGCGCTCCAGGAGAAGCGAGCCAAGGCCAGAGCCAGTTCCACCT*CCAACAGCGTTGAATACAAGGAATCCCTGGAGACCAGTGCAG*TTGT
CTGAAAGCTTCCTGATACGGTCAAGGCACAGATCAACAATCTCCTTGCCAATGGTGTAATGACCACGGGCGAAGTTGTTGGCTGCATCCTCCTTGCCACT
GATAAGCTGCTCAGGGTGGAAGAGCTGGctgGTAAGCACCAGTCCTCACCTCATCAATCACAGTGGGCTCGAGATCTACAAAGACAGCACGGGGGACATG
CTTCCCAGCACCAGTCTCGCTGAAGAAGGTGTTGAAAGCATCATCACCTCCCCCAACGGTCTTGTCACCGGGCATC*TGGCCATCAGGC*TGAATGCCAT
GCTCGAGGCAGTAGAGCTCCCAGCACGCGTTCCCGACCTGGATGCCGGCCTGGCCGATGTGGATCGAGATGCACTCCCT*CATGGCGGCGGGTGGGGGTG
GTTGGTGGGCTGCGCCGCTGGCGAAATGGGGAAGGAGGAGGGCGAAGGCTAGGATGCGCGGAGAGAGGCGAGTACGAAGACGCcc*tCGTGCCGAattgc
ctgca
page-top