Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5341  (registered. 2012)
Contig Information
Length 1115 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_yd Spikelet at late flowering 1
Wh_SHC Shoot grown with cold treatment 1
WH_XA Root 1
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242088733|ref|XP_002440199.1|| hypothetical protein SORBIDRAFT_09g027640 [Sorghum bicolor]
Score 390
Evalue 2.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5341
ATCGAACGGTGGAAGAAATTCTACATTCCCTGACTGACCAATCAATGCCAAACTGATAAGTAGTGACGGAACCAAAGGATTATACAGTCAACTATAAGGG
ACTATATCTCGCACCAATATTAACACCCACCCCAGGCCCTCAAGCCTGAAGAACTCCAGCAAAAGGAGATTCGATTTACCGACCGAGCAACCCATAAATC
ATGTACAGCAAAAACGTGAATTGGATGTGGAAAAATCGCAACATCGCTTGTGTCGGCCAACTCCCAACGCTAGCAGCCCACGGCCGCAGCACCTTCTTTC
GTAGCAACAGGGGCGCCACCTTCTTTTGGAGCAACGACAACAGAGATGCCACCTTCTTTCAGGGCAGCAGGGATGCCGCCTTCTTTCAGAGCAGCAGAGA
TGCCGCCTTCTTTTGGGGCAACAGGGACACCCACAGTGACACGGAGGATTGCTTGGGCGCTTAAAGCAGAAAGCTTAGATAGGCAGAAAGCCTCCCAGGT
TTCAGCTTCTGGTGAAATAGCAGGTGCGCTGTCATCTTCGCCTAAACCAGAGGCTTGAGACTTCTCATAGAATGCTTGAAGCTCCAATGAAAGGTTACGA
GCAGCCTCCCTTGATTCAGGAAGCTGGTCGCTGAGCTGGGTTGCTGCGACCTGAATGAGCTTGTCCATTCCGTATTCTTTGATTCCCTCCAGACCAAGGC
GTGGTACACTCTTACTGAAACAAACAGATGCTTTTGCTCGAATTCGTGGATTCCTGTTTTTGAGGTAGGGCTGCATTTTTGGTAACAATATAGAGGGGGA
GATCCAGCTTGTCATTGACATAAGGGCTGCCTCAGCTGCTTCACAAACAAAGCGCTTGTCTTGTGAAGATTTCAGAAATAGCGGCATTAGCAGCTGATCA
ATCAAGTCGACCATTTGTTCACCGTATGCCTTAAAGATGTCAGCGCAGGTCATAAGTGCGGTTTTGCATAGAGCACTCCTTGGATTCTTAACAGATTTCA
CAATAAGAGGAACTAGAGGCTCCAGCAGCTCCTGCAACCTTTGCTTGTGATATATCGCCAACTGACGAACATTATTAAGAGCTTCACATGTCTTGATCCA
ATCCTTTGAATCCAA
page-top