Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16265  (registered. 2002)
Contig Information
Length 1148 bp
Clones 140 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 15
Wh_SL Seed DPA30 24
Wh_dL Crown of seedling 17
Wh_e Seed DPA10 16
Wh_f Spike at flowering date 12
Wh_h Spike at heading date 6
Wh_oh Pistil at heading date 4
Wh_r Root 13
Wh_yd Spikelet at late flowering 21
Wh_yf Spikelet at early flowering 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Mus musculus]
Score 603
Evalue 2.27879e-92
Total Hit Count 430
Registered year 2002
Contig Sequence     [ Download ]
>Contig16265
tttttttTTTAAACAG*AGAGCATTTTATCAGATAACATTTAAGATAAC*C*GGATGAGGTCTCGAAATAGCACTTAATAAG*ATAAACAT*CCACATTA
CAT*C*TAG*A*GGC*AACCACG*AGTTCGCAAATCAACAAACAT*CAGGCAAAACTTAAAAACGATGGTTCCAGGAACATAGTTCTATATCCTTGCAGA
TAACTGGCTATAGCAAAACGACTCAACGCCTCAGAATCAGGCCTTGGCAGCAGCCTGGGCAGCGGCATCCCGCTTCCTCTGCTCCTCAATGATGGTGAGC
TTGATACCCTT*GCCCTTGGGGAGGCTCACCCATGGCTTGGTGCCCTTGCCAATGGTGAATACATTGCCCAGACGGGTGGCGAACTGGTGGCCCTGGGCA
TCCTCAACGTGGATGGTCTCGAAGGTTCCCTTATGCTTCTCCCTGTTCTTGATCACACCAA*CACGCCC*AGTGTTGC*GCCCGCCAGTCACCATGACCA
CGTTACCAACGTCGAA*CTTGATGAAGTCAACAAT*C*TTGTTGGTCTCCAGGTCGAGCTTGATAGTGTCATTGGCCTTGATGAGAGGGTCTGGGTAG*C
GGATGG*TGCGGCCATCAT*AGGTGTTCAGG*TAGGGGATGCCCTTCTGGCCGAACTGGACAGACC*TGACC*TTGCAGAGCTTGAACTTAGCATCCTCA
TCCCTGACAGAGTGAAGGCGGAAGCGGCCCTT*GGTGTCATACAGAAGCCTGTAGTTCTCACCAGTCTTGGGAATGGAAATGA*TGTCCATGAAACCAGC
A*GGG*TAGGTCTTGGTCAGTGCGGACCTTTCCATCAACCATGATATGACGCTGCATAAGGATAGACTGCACTTCACGGTAGGTGAGAGCATATTTCAGT
CTGTTCCTCAGGATGAGGATCAGAGGAAGGCACT*CCCTG*GCCTTGTGAGGACCAGATGATGGCTTGGGGGCAAAAGCTCCACCAAGCTTGTCAAGCAT
*CCAGTGAGACGGGGCATTGAGCCTCTTCAGATGCTTCTTCAAACCCCTAGCCATGGTTGCGAGCTCGGGCTAGGTCGCCGTGCTTACTCGT*CTTCGGG
CACCACCGCCGCCTGCTCCTT*CT*CCTGTGCTACGCGCCGCCGCCgc
page-top