Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig534  (registered. 2012)
Contig Information
Length 998 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115450571|ref|NP_001048886.1|| Os03g0135300 [Oryza sativa (japonica cultivar-group)]
Score 403
Evalue 2.00E-110
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig534
CGGCACGAGGCTTTGGAGATGCCTTTACGGGCCGCTGGCCGCAGGCAGAGTCATGCTCTTGCTGTGCGGTAGCATCTGACACTAGCTATCTCCTACCCAC
CTATCCCCCGTCCGTCCGCCCGTCTAGGTCTCTGGAGAAGCGGCGATGGCGGCGCCCGTGACGGTGTACGGGCCGGCGATCTCGCCGGCGGTGGCGCGCG
TGGCGGCGTGCCTGCTGGAGAAGGACGTGCCGTTCCAGCTCGAGGCGGTGGACATGTCCAAGGGCGAGCACAAGTCCCCCTCCTTCCTCAAGCTCCAGCC
CTTCGGCCAGGTCCCCGCCTTCAAAGACCACCTCACCACCGTCTTCGAGTCAAGGGCCATTTGCCGTTACATCTGTGACCAGTACTCCGACCGTGGCAAC
CAGACTCTCCTAGGCCGGAAAGAAGACGGCGCGGTAGGCCGCGCTGCCATCGAGCAATGGGTAGAGTCCGAAGGCCAAGCATTTAACCCGCCGAGCTTGG
CCATCGCATTCCAGCTCACCTTCGCGCCTCTCATGGGCATGGCCACCGACATGGCCGTGGTGGAGCAGAATGAGGCGAAGCTCGCCAAGGTGCTCGACGT
GTATGAGCGGCGGCTGGCGGAGAGCCAGTATTTCGCCGGCGACGAGTTCACCCTTGCCGACCTTGTGCACATGCCCAACACTGATCTCCTCGTGAGCAAG
GCCGGCAAGGCGGGTCTGATCACCGAGAGAAAGAATCTGTCCAGATGGTGGGATGAGGTCTCGGCTCGTCCGTCATGGAAGAAGGTTGTCGAGTTGCAGA
GTGTACCACGGCCCTCTAAAGCTTGAGGGCCCCTTCAGTTTTTTTAGCCGAGCAGCTTCTGGTGGCAATTAGTCACATTCTGTTATGTGTTGCCATCACT
CCTAAATGTTATTGTGTTGTGAAAGACTCGGGCTGCTTTGTACAATATGTTATCCTGCTATCTATCTCTGTGGTATTATTGAGTTTGCAAAAAAAAAA
page-top