Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16259  (registered. 2002)
Contig Information
Length 1363 bp
Clones 129 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 11
Wh_dL Crown of seedling 36
Wh_e Seed DPA10 10
Wh_f Spike at flowering date 9
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 6
Wh_r Root 27
Wh_yd Spikelet at late flowering 13
Wh_yf Spikelet at early flowering 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glyceraldehyde-3-phosphate dehydrogenase [Triticum aestivum]
Score 1104
Evalue 3.3851e-168
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16259
ttGACCGGAATGACATGTTATGG*ATAACTCAAG*AAG*ATGAGTGAAAATGACTCATGATTTAGTTCAAGC*AAGTACATAATACCACCAAAATGTGAG
CTCTAAGCCCAACCAACCAT*CAGG*ATACATCCAATAAAAGGTTTTTAGCTGACATAATTCCATACAAAAATTTATTCTCAG*AAGAAAGGCTTTGAAC
ACTCCTCTGGGGCAAACCACTCTCCCCAGTAACTTCATGCCTCTCATTTACTTGGAGCTGTGCATGTGACGGATGAGGTCGACCACACGGGTGCTGTATC
CCCACTCGTTGTCGTACCAGGAGACAAGCTTGACAAAGTTGTCGTTCAGAGCAATCCCGGCCTTGGCATCAAAGATGCTGGACCTGTTGTCACCCTGGAA
GTCAGTGGAAACAAGGTCCTCATCCACGTAACCCAAAATGCCCTT*GAGGTTTCCCTCAGACTCCTCCTTGATAGCAGCCTTAATCTGATCATAGGTTGC
TGGCTTCGCAAGTCTAACAGTCAGATCAACAACAGAAACATCAACAGTAGGAACACGGAAGGCCATT*CCAGTCAACTTT*CCGTTAAGCTCTGGGAGCA
CC*TTGCCAACAGCCTTTGCGGCACCAGTGCTGCTTGGAATGATG*TTGAAGCTGGCAGCCCTTCCACCT*CTCCAGT*CCTTGCTGGAAGGACCATCAA
CAGTCTT*CTGGGTTGCAGTCATGG*CATGAACTGTGGTCATCAAACCCTCAACAATGCCAAACCTGTCATTGATAACCTTAGCAAGAGGAGCAAGGCAG
TTAGTGGTGCAACTAGCGTTGGAGACAATGTCGATGTCAGACTTGTATTCCTTCTCATTGACACCACAGACAAACATGGGAGCATCTTTGCTGGGAGCAG
AAATGATGACCTTCTTGGCACCACCCTTAATGTGAGCTGCAGCCTTGTCCTTGTCAGTGAAAACACCGGGTGGACTCAACAACGTACTCAGCACCAGCAG
CAGCCCATGGGATCTCCTCAGGGTTCCTGCAGCCAAACACAGCTACCTCCTTCTGGCCGAAGAGAAGGGTCCTTGGAGTCCTTCACCTTAACTT*CATGG
TGCTTCCACTGT*CCATGGACAGTGTCATACTTGAACATGTAGGTCATGTAGTCGGTGGTGATGAAGGGGTCGTTGACGGCGACGAGCTCGACATCGGGG
CTCTGGAGCGCAACCCTGGCCACAAGCCTGCCGAT*CCGGCCGAAACCATTGATGCCGAT*CTTGATCGGAG*CCATGGGG*AAGGAAAT*C*TGGAGCT
GCGACGGACGGAGGGGAGGTTGAGAACAG*ATCGAGG*ATTGGGACGGCCCtcgtgCCGAatt
page-top