Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16254  (registered. 2002)
Contig Information
Length 623 bp
Clones 119 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 119
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-thionin
Score 278
Evalue 3.25977e-23
Total Hit Count 105
Registered year 2002
Contig Sequence     [ Download ]
>Contig16254
tttagcacgcaagagatcttaCGACTTGCATATATCCACGGATAAATCAATTTATTTTGTTACCAAAAGCAA*CGCGTGGCATGCAT*CATG*CTACGTA
CAGCGGTG*ACGCGCCGGCGGGTCGCCGCGCCACGTTTTATTACATCTCCTGACAG*AGGCGGCGAGTGGG*TACATGGTAGTTAAGACTTAAGATACAT
AGGTGGCTTCGTTTGACAGACGGCGCCATGG*ACGGGGCGGGGGTGGGGGAGCTCGCGCGCGGAGCGTCTGCCCTAGCACTCCCTCTGGCAGGTGCAGCG
CCTGATTTTGCAGTAGCCGGCCGTCCATTTTGCGCCGTGCTCGCTGAGGCACGT*CTTGGTGCAGCT*C*TTGTCCGAGACGCACGGGAACGAGTGGTGC
TGGCTCTTCCCCGTGCAAATGCGCGCCTCCGCCACGCCGATGCCACCGCCGCCGCTGTAGGAGGAAAGCAGGAGCAGCACCAGCATCACCGCGCACACGG
TCGCCTTGGGCTTGAACTCC*ATTTGCTT*CTGTGGGGGTAGGTAGGTTGATGGAGCAAAGCCTTTTTTTCTCTCTTT*AGGTGAAACAAGCTATGGCTT
CTGcctcgtgccgaattncctgc
page-top