Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16252  (registered. 2002)
Contig Information
Length 1408 bp
Clones 115 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 12
Wh_SL Seed DPA30 25
Wh_e Seed DPA10 21
Wh_f Spike at flowering date 16
Wh_h Spike at heading date 9
Wh_oh Pistil at heading date 9
Wh_r Root 8
Wh_yd Spikelet at late flowering 13
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1108
Evalue 1.09066e-169
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16252
gaggaatTCGGCACGaggGTCCCGTCCCGTCCCCAGCCAACCTCCCATCT*CCGT*CTCGCGTCGCGGCGGCAGTTCCACTCCCTCGCCATGGG*CAAG*
ATTA*AGATCGGAATCAACGGTTTCGGAAGGATCGGGAGGCTCGTCGCCAGGGTAGCCCTCCAG*AGCGACGATGTCGAGCTCGTCGCCGTCAACGACCC
CTTCATCACCACCGAGTACATGACCTACATGTTCAA*GTACGACACCGTTCACGGCCACTGG*AAGCACAGTGACATCAAGCTCAAGGACGACAAG*ACT
CTGCTCTTTGGCGAG*AAGCCAGTTACCGTCTTCGGCGTCAGGAACCCTGAGGAGATCCCGTGGGGTGAGggcTGGTGCCGATTACGTTGTGGAGTCCAC
CCGGTGTCTTCACTGACAAGGACAAGGCCGCTGCTCACTTGAAGGGTGGTGCCAAGAAGGTGGTCATCTCTGCCCCAAGCAAAGATGCCCCTATGTTTGT
GGTTGGTGTCAACGAGGACAA*GTACACCT*CAG*ACGTTAACATTGTCTCAAATGCTAGCTGCACCACTAACTGCCTTGCTCCCCTAGCTAAGA*TCAT
TAATGACAACTT*CGGTATTATTGAGGGTTTGATGACCACTGTTCATGCCATCACTGCC*ACACAGAA*GACCGTTGATGGTCCCTCGAGCAAGGACTGG
AGAGGTGGCAGGGCCGCAAGCTTTAACATCATTCCCAGCAGCACTGGTGCTGCTAAGGCTGTTGGTAAGGTTCTTCCTGAGCTGAATGGCAAGCTTACCG
GTATGTCTTT*CCGGGTTCCCACTGTGGATGTGTCAGTTGTTGATCTCACTGTTAGAA*CCGAGAAGGCTGCATCATA*TGATGACATCAAGAAGGCTAT
CAAGG*CTGCATCTGAGGGGAAGCTCAAGGGGATCATGGGTTACGTTGAGGAGGATTTGGTCTCCACCGACTTTGTTGGTGACAGCAGGTCGAGCATCTT
TGATGCCAAGGCTGGAATTGCTCTGAACGACCATTTCGTCAAGCTTGT*CTCGTGGTATGACAACGAATGGGGTTACAGCAACCGCGTTGTCGACCTGAT
CCGCCACATG*GCCAAGACTCAGTAGAGTGCTCTGCTTT*CCTTTGTGGCGCCTGGTCAGAGGTGTCCCTGCTTTGTCTATGCGAAGAATAAATGTGGAT
GGCGTCGCCAGACGACGCCTGGTTCATGTTAGTTGGACATGAGTTACCTT*C*TGTTTTCCGCATCAACTAGTAT*CTGTAATGGAGTTGCTAATCAAGT
ACT*CTTTTTTGGTTGTGGTTTGTG*AAG*AATATATAAATCGTTCAGT*CCAGTACTTGTGTTTGCCTTAATAGAGAG*ATAACTCTATtaactctctt
actttctg
page-top