Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16245  (registered. 2002)
Contig Information
Length 2427 bp
Clones 103 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 22
Wh_SL Seed DPA30 22
Wh_dL Crown of seedling 10
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 9
Wh_oh Pistil at heading date 7
Wh_r Root 5
Wh_yd Spikelet at late flowering 15
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 2398
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16245
attcggcacgaggCGCCTCCTGCACGCTTCTCCTCCGCTCCCCGCCCCGCCTCGAGCAGCTCAGG*AACGCGCGCAGCCATGGCGACGG*AGACCGAG*A
CCTTCGCCTTCCAGGCCGAG*ATCAACCAGCTCCTCTCGCTCATCATCAACACCTTCTACTCCAACAAGG*AGATCTTCCTCCGCGAGCTCATCTCCAAC
TCCTCCGATGCCTTGGACAAG*ATCA*GGTTCGAGAGCCTCACGGACAAGAGCAAGCTCGATGCGCAGCCCGAGCTCTTCATCCACATCATCCCCGACAA
GGCGACCAACACGCTCACGAT*CGTCGACAGCGGCATTGGCATGACCAAGTCGGACCTCGTCAACAACCTCGGGACCATCGCCAGGTCGGGGACCAAGGA
GTTCATGGAGGCCCTCGCCGCCGGCGCCGACGTGTCCATGATTGGGCAGTTTGGTGTCGGTTTCTACTCCGCCTACCTCGTCGCCGAGAGGGTTGTCGTC
ACCACCAAGCACAACGACGACGAGCAGTACGTGTGGggaGTCCCAGGCCGGTGGCTCCTTCACCGTCACTCGTGATACGTCTGGGGAGCAGCTCGGCAGG
GGTACCAAGATGGTCCTCTACCTCAAGGACGACCAGATGGAATACCTTGAGGAGCGCCGCATCAAGG*ATCTAGTTAAGAAGCACTCTGAGTTTATCAGC
TACCCCATCTCCCTGTGGACTGAGAAGACCACTGAGAAGGAAATTTCTGATGATGAAGATGAGGAGGAGAAGAAGGATACTGAGGAGGGCAAGGTTGAGG
ATGTTGATGAGGAGAAGGAAGAGAAGGAAAAGAAGAAAAAGAAGATCAAGGAAGTCTCTCATGAGTGGAACTTGGTCAACAAGCAGAAGCCTATCTGGAT
GAGGAAACCAGAGGAGATCAACAAGG*AAGAGTACGCAGCTTTTTACAAGAGCTTGACCAATGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCTGT
TGAGGGTCAGCTTGAGTTCAAGGCTGTCCTGTTTGTGCCCAAG*AGGGCCCCCTTCGACCTCTTCGACAACAAGAAGAAGGCCAACAACATCAAGCTGTA
CGTGCGCCGTGTCTTCATCATGGACAACTGTGAGGAGTTGATCCCTGAGTACCTGAGCTTTGTCAAGGGTATTGTTGATTCAGAGGACCTTCCCCTGAAC
ATCTCCCGTGAGACTCTCCAGCAGAACAAGATCCTCAAGGTCATCAGGAAGAACCTTGTCAAGAAGTGCATTGAGCTCTTCTTTGAGATTGCTGAGAACA
AGGAGGACTACAACAAGTTCTACGAGGCCTTCTCCAAGAACCTCAAGCTTGGCATCCACGAGGACTCCCAGAACAGGACCAAGATTGCCGAGCTTCTGAG
GTACCACTCCACCAAGAGTGGCGATGAGCTGACAAGCCTGAAGGACTATGTGACCAGGATGAAGGAGGGACAGAACGAG*ATCTACTACATCACTGGTGA
GAGCAAGAAGGCTGTGGAGAACTCTCCCTTCCTTGAGAAGCTGAAGAAGAAGGGCTATGAGGTCATCTACATGGTTGACGCCATTGATGAGTATGCCATT
GGTCAGCTCAAGGAGTTTGAGGGGAAGAAGCTTGTCTCTGCCACCAAGG*AGGGTCTGAAGCTTGATGAGAGCGAGGACGAGAA*GAAGAAGCAGGAGGA
GCTCAAGGAGAAGTTCGAGGGTCTGTGCAAGGTCATCAAGGAGGTGCTGGGTGACAAGGTGGAGAAGGTCATCGTCTCTGACCGTGTTGTGGACTCTCC*
TTGCTGTCTGGTGACTGGTGAGTATGGGTGGACTGCCAACATGGAGAGGATCATGAAGGCCCAGGCCTTGAGGGACTCGA*GCATGGCTGGCTACATGTC
GAGCAAGAAGACC*ATGGAGATCAACCCTGAGAACGCCATCATGGACGAGCTTCGCAAGCGCGCCGACGCCGACAAGAACGACAAGTCTGTCAAGGACCT
TGTGATGCTGCTCTTCGAGACCTCCCTGCTCACCTCCGGCTTCAGCCTGGAGGACCCCAACACCTTCGGCACCAGGATCCACCGCATGCTCAAGCTTGGC
CTGAGCATTGACGAGGACGACGAGGCGCCTGAGAACGACACCGACAT*GCCACCCCTGGAGGATGACGCTGGTGAGAGCAAGATGGAGGAGGTCGACTAA
GCGCAAGGCCGTCGGCTGTCGTCGTTGGATGTCCATGCCCTGCGTTGTTTTTATCTTTAGTGTCGAAGTTCGATGGTTTTGGCACGTTTAGCTGTATCGG
TTTTGTCTTTTGGCTGGCCAAACATTAAGCGCGGTTAGCTGTTTGTGGTACTCGTGGAACAGTTCGTTATTGTTGGTTCTACAATATGTGTTAG*CTATA
TTTTTATattccctgctaaaaaaaaaa
page-top