Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16241  (registered. 2002)
Contig Information
Length 1239 bp
Clones 99 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 13
Wh_e Seed DPA10 86
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-gliadin [Triticum aestivum]
Score 495
Evalue 7.66495e-48
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16241
ttttttttttaATGCTGGCAAACAAG*AACTTTGTTT*GT*CTTTTATTCCCAAG*C*TTGAACTAGCACTGGCCGGTGTCACACATGATGGTGCACTCC
ACTTTATTTGTCATCGT*TACAT*CGATTGGTGCA*TCAGCTAAGCCAACGATGATCCATCTACCTATTAGTATA*GCTCTTCAGTTTTTCATTGGCCAC
CAATGCCCGCGACTATGCTGGCAAATGGTGCCCTCATGATGGAGCACTCTGGTGGGACATACACG*TTGCACATGGATGGAAGAGTTTGCAATACCAATG
ATCTGATCGCCTCCAATTGAGCTGGTTGTTGTGGTTGGATGATGCCCTGGCCTTGGACTAGAGAACCTTGACCCACCTGTTGCTGCTGAGATAGTGGCAG
AAAGATATGCATGCCTTGTTGTTGTTGTTGTTGTTGCTGCTGCT*GCATGATGATGGAATGCACGACGCTATGGATGGCTGCGCACTGGAGCTGTTGAGG
AATCTGTGCTAGTTGTTGGCAGCATTGTTGCCGCATCACTTGGCAATCGCTTTGTGGCCAGATTATTGACCAGAGGGATGACACCAATGACGCAGGTTTG
CATTGTTGCAAGAGGATATT*CTTGCATGGGTTCAACTGTTGTTGTAGAGATGGTTGAATGAATGACC*GTTGTTGTTGGGGGAATGATTGTTGC*GG*T
TG*TTGGGGCTGCGGTAATTGTTGTTGGGGCTGGGGAAAAGGTTGTTGTGGTTGCTGGAGCTGGGGAAA*TG*G*TTGTTGGG*G*TTGTTGAGT*C*TG
GGGGAATGGTTGTTGTGGTTGTTGGGGAAATGGTTGTTGGGGTTGTTGAGT*CTG*GGGAAATGGTTGTTGTGGTTGCTGGGGAAATGGTTGTTGTGGTT
GTT*GAGT*CTGGGGGAATGGTTGTTGTG*GTTGTTGGGGGAATGGTTGTTGGGGCTGGAGAAATGG*TTGTTGTGGTTGCT*GAGGC*TGGGGAACTTG
TTGTTGTGGTTGATGGGGGAA*TGTTTGTTG*AGGTTGGGGAAATGTTTGTTGTGGTTGCTGGGATAATGGCTGTTGGAG*CTGGGGGACTAGTTGTTGT
TGTAGCCATTGTACTTGGCCGCTAGGGTCGACCTGGATATTGGCGGTGCCgcaTG*GT*TATTGCCATCGCAAGGATTGTCAGGATGAGTAAGGTCTTCA
TGGTGGATTTGCGTTAACTACTACGTACTTtattttctc
page-top