Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16239  (registered. 2002)
Contig Information
Length 1663 bp
Clones 97 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 20
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 11
Wh_f Spike at flowering date 10
Wh_h Spike at heading date 24
Wh_oh Pistil at heading date 5
Wh_r Root 13
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine synthetase 1 [Triticum monococcum]
Score 665
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16239
ttcGGCACGAGGCAGCAGCGGCAGCGCAAgcaGGTAGATTGGAGTATCACCACCACCGCGCAAG*AAATGGCGACCGAG*ACTTTCCTCTTCACCT*C*T
GAGTCTGTGAACGAGGGCCAcgcCTGACAAGCTCTGCGACCAGGTCTCCGACGCTGTGCTTGACGC*GTGCCTCGCCCAAGACGCTGACAGCAAGGTTGC
CTGTGAGACATGCACCAAGACCAACATGGTCATGGTTTTTGGTGAGATCACCACCAAGGCCACTGTTGACTATGAGAAGATTGTGCGTGACACCTGCCGC
AACATTGGCTTCATCTCTGATGATGTTGGCCTTGATGCTGACCGGTGCAAGGTGCTTGTCAACATAGAGCAGCAGTCTCCTGACATTGCCCAGGGTGTGC
ACGGACATTTCACCAAGCGCCCTGAGGATATTGGT*GCTGGTGACCAGGGTATCATGTTTGGCTATGCCACCGATGAGACCCCTGAGCTCATGCCCCTCA
GCccaTGTGCTTGCCACCAAGCTGGGTGCCCGCCTCACTGAAGTCCGCAAGAATGGCACTTGTGCCTGGCTAAGGCCTGATGGCAAAACCCAGGTCACGG
TTGAATACCTCAACGAGGGAGGTGCCATGGTTCCTGTACGTGTGCACACTGTTCTGAT*CTCCACCCAGCATGATGAGACTGTCACCAATGATGAGATTG
CTGCGGACCTCAA*GG*AGCATGTCATCAAGCCGGTGATCCCTGAGAAGTACCTGGACGAGAA*GACCATATTCCACTTGAA*TCCATCAGGCCGCTTTG
TCATTGGTGGCCCTCATGGTGATGCTGGTCTTACTGGTCGCAAGATCATCATCGACACCTA*TGGTGGCTGGGGAGCACACGGA*GGTGGTGCTTTCTCT
GGCAAGGACCCAACTAAGGGTTGACC*GCAGTGGCGCCTACATTGCCAGGCAGGCTGCCAAGAGCATCATTGCTAGCGGTCTTGCACGCCG*CTGCATTG
TTCAGATCTCCTACGCCATTGGTGTGCCTGAGCCCTTATCTGTCTTCGTTGACTCTTATGGTACTGGCAAGATCCCCGATAAGGAGATCCTCAAGATTGT
GAAGGAGAACTTTGACTTCAGGCCTGGGATGATCAGCATCAACCTTGACTTGAAGAAGGGTGGCAACAGGTTCATCAAGACGGCCGCTTATGGCCACTTT
GGCCGTGAGGATGCTGACTTCACCTGGGAGGTTGTGAAGCCCCTCAAGTTTGACAAGGCCTCTGCTTGAGAGGTGGGTATGAAGGAGTCTAATCATTCCT
GCTGCTGCCGCTGGTGGTTGTATCTTGGATAATTGAATTCCTTCTCTTTAGAAGGAAGCAGGGTTTCAACATCGCCGTGGACACGCTGAATTGGCATCTA
GTGATTGGTATTTTGGTATGGAATACAAAAATATGTGCTGAGTTAATACTAGTCGGGTCTTTTGATGT*CTTCTGTGCTTTCTTTTTGCTTTTTGAGTCT
ACTGAAACCGCAGTACTTGTGCGGTTTCCTCTATCGGTCGT*CCAGCTATTTTTTAGTACTGCATCTGTAAAACCATATGTGATCCTAGTACCCTGTTCT
T*CCCAATTCTCGATGCTTGGTGCAGTCTTAACcttctcaatattcagtttgagcgataaggt
page-top