Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16231  (registered. 2002)
Contig Information
Length 1155 bp
Clones 89 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 8
Wh_e Seed DPA10 81
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-gliadin [Triticum aestivum]
Score 406
Evalue 1.45632e-37
Total Hit Count 476
Registered year 2002
Contig Sequence     [ Download ]
>Contig16231
ttttttttttttttttttttttttttttttttttttttttttttttttttaAACAAGAACTTTGTTTGTGTTTTATT*CTGAAG*CTTGAACTAGCTCTG
GTCGGGGTCACACATGATGGTGCACGCCACTTTATT*CCTCATCGCTACAAAGACTGGTGCAT*CAGCTAAGCAACGATGATCCATCTACCTATTAGCAT
AACTCTTCATTTTTCATTGTCCACTGATGCCGGCGACTATGCTGGCAAA*TGGTGCGTTGATGGTGGAGCAGTCAGGTCGGACATACACGTTGCACATGT
TTGG*AAGGGTTCTCAATACCAATGACCTGATCACCTCATATTGAGCTGGTTGTTGAGGTTGGATGATGCCCTGACCTTGGACGAGCTGAAACAGTGGCC
GGAGGATCTGTATGCCTTGTTGTTGTTCTTGCTGCATGACGATGGAATGCACGACGCTATGGATGGCTGCACACTGGAGCTGGCGAGGAATCTGTGCTAG
TTGTTGGCAACATTGTTGCTGCATCACCTGGCAATCACTTCGTGGCAAGATCATTGACACGAGGGATGACACCAATGACACAGGGTTGCATTGCTGTAAG
AGGTAATT*CTTGCAAGGGTTCATCTGTTGTTGTAGATATGGCTGAATCAACGGTTGTTGTTGCTGGGGGAATGATTGTT*GCGG*TT*GTTG*GGGCTG
GGGAAAAGGTTG*TTGTGGTTGCTGTGACTGGGGAAATGGTTGTTGGG*G*TTGTTGAG*GCTGGGGGAATGGTTGTTGTGGTTGTTGGGGAAATGGTAG
TTGGG*CTTGTTGGGGCTGGGGAAATGGTTGTTGTGGTTGCTGGGGCTGCGGAAATTGTTGTTGTGGTTGCTGGGGCTGGGGAAATTGTTGTTGTGGTTG
ATGGGGG*AATGTTTGTTGGGGTTGGGGAAATGTGTGTTGTGGTTGCTGGTAGAATGGTTGTTGGGGCTGGCGGAATGGTTGTTGTTGTGGCCATTGTAC
TTG*GCCGCTGGGGTCGACCTGCATATTCGCGGTGGCGATAGTTGTTGCCATCGCAAGGTATTGTTAGGATGAATAAGGTCTT*CATGGTGG*ATTTGTG
TTG*GCTACTACTTAATTGGATTTGATACTTGTGCTCTAGTTGtgtgaaggatgg
page-top