Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16228  (registered. 2002)
Contig Information
Length 1159 bp
Clones 87 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_SL Seed DPA30 13
Wh_dL Crown of seedling 13
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 8
Wh_r Root 16
Wh_yd Spikelet at late flowering 9
Wh_yf Spikelet at early flowering 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1091
Evalue 5.40713e-117
Total Hit Count 492
Registered year 2002
Contig Sequence     [ Download ]
>Contig16228
ttttttttttaACAAAACAGAGGACAAGTTCTattcaaacATAAAAACACAGG*ACAGG*AATAAACTAAATATTTAGTTTTCAACTCATTACCTCCATC
CAG*AAAGTAACACGAACAAAATAAG*ATAGCGG*AACACTGGCTAGGAATGTCGACAG*AAGTACTCAAG*AAATCAGCCATCAAAACTGACTACAA*A
GTTCACGACA*CCCAGGTGGCACATATATCATCTT*CTAG*ATATGAAGCAGCAAAATAGCAACTTCTATCCTCTACTCAGCAGCAGCAACCTCCTCTGC
TCCAGGAATCACC*TCATCTCCATCAGCAGGCCTGTCAAGC*TTCACACCAACATCCTCCTTGTAGTCACCGTGAACCTCCATGAGCTTCCCCAGGTCGA
ACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCCT*GAGGTGGCCTTCTCAATCTCCTTTCCAATCACCTCAG
GGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTG
GGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCTT*GGTGAAGCCAATGGCGAACATGCGGAGCATGTAGTTGTCA*GTGGTCTTCACATCCACAT
GAGCCTCAATGAGTGTCTGCCACTTCCTCACAAG*AGACCTGAGCTTGTCAGTGG*TGAA*GTCCATGCCCC*AGAAGTTTGTGAGGACATTCATCCCTT
GCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGATACTTCGAACACCCTGTGCTTCAGACCCTC
TGAGGCAATCTTGGTACCCTGCGTCCTGGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGGCGCCTTGATGTCATACCACTGCTT*CTT
GGTGAACGGATCGACGGCCTTCTTCTTGCTTCCCTTCCTCCCCTTGGAGATGCGCTTGTT*CTTGCCGACCG*CCATGGTTGCCGCTGCGgcgTGGA*GT
GGCGGCGCTGCGGCGT*CTGGGGG*CTTGAGCGTCGGGGCTTCtcctcgtgccgaattc
page-top