Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16226  (registered. 2002)
Contig Information
Length 897 bp
Clones 86 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 10
Wh_SL Seed DPA30 12
Wh_dL Crown of seedling 20
Wh_e Seed DPA10 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_r Root 10
Wh_yd Spikelet at late flowering 12
Wh_yf Spikelet at early flowering 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L21 [Zea mays]
Score 495
Evalue 7.57913e-80
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16226
cgagaagtattgaatcgattgGGCCAAACTCgaaagaCAAACAGCAAGCTGCAGCAGCCCTGCAGTACCAAGGCTGTAGAGGCGAAGTGAACCTTTGGAG
GCAAGCAATGTAACTATATAGTTCAACAG*AGCACATCATCATTCTGAAGG*AAATAGCACAGTATAG*CATTTCTGCAAAACTCATGATAGCAAC*CTA
CACCG*AATAT*CTT*CTTGACATGAATAAAG*AC*CCAAC*CCAG*ACTACTGC*TCA*G*AG*AGCAAATCCTACTCATAAG*AGCACCATAG*ATTT
GAACTGGTTGTGCAGGCAGATAACCCAAACACCCTAGTAACCACCCTTGAGATCATTGACCACATCGTAGGGAATGGGAGTGACGGTCTCAATTGTGGTA
CCCTCGACCATGAACCCAGGTTTAGGGCCGAGTGGCTGCCTCTTGGTGCTGATGACCTCACCGCGCGCCTTGGCTTCCGCCTTGAGCTGGTCGTTCTTCA
CTTTCCTCAGGCGGAACTCCTCAGCACACCTGGATGGCTGCACATGCTCAACACGGACATGG*ATCCTTTT*CCTGATAATGCGGTTTCCAACCTGC*TT
GTTGAT*CTCGACGCCGATGGCGCGCTTGGT*GACGTTCCACACGCGTCCGGTGCGG*CCCGTGGTAGAA*CTTGTGCGGCATACCC*TTGTGCACGG*C
GCCGTTCACCTT*GACGT*CGACGTACTCGCCGACCTTGTAGGTGCGCAGGTAGG*TGGTGAGCGGG*ATGTAACCCTTCTTCCGGAACGGGCGCGCGAA
CAGGTCGCGCGTCCGCGACCGCAGACCGTGGCCCGCCGGCAT*CCTGCTCCT*CCTGCTTTGCTTCGCGGGGCGGCGGCGGGAGAAGGGTGGTTggt
page-top