Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16225  (registered. 2002)
Contig Information
Length 1630 bp
Clones 86 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 15
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 6
Wh_oh Pistil at heading date 6
Wh_r Root 8
Wh_yd Spikelet at late flowering 14
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16225
ttttttttttggcaaaagcagcagaaaaacaagcTAACAAGTTGCAATCTAATAACTTGCATTTCACAACAAATCAGTCTCAGGGGCACAGG*AGTTTAG
CCGACGCAGG*AATAGAAATACAGTAATTAAACGACAG*ACAG*ATCAT*TGCTCGCTCGGG*A*TAAG*AGTCTGAAG*CAACAAAAGCAATG*ACCGT
G*AACAAAAACATTCTGCTAG*ATAGCACGCCTATTTCTTCTTGATGGCAGCCTTGGTAACCTTGGCGCCGGTGGGGTCCTTCTTCTCCACGCCCTTGAT
GACACCAACAGCAACCGTTTGTCTCATGTCACGCACAGCGAAGCGGCCAAGAGGAGGGTAGGTGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATC
ATCTTGACGATACCAGCGTCACCGTTCTTCAGGAACTTGGGCAGCGCCTCCAGCTCCTTACCAGATCGCCTGTCGAT*CTTGGTCACCAGCTCAGCAAAC
TTGACAGCAATGTGGGAGGTGTGGCA*GTCCAGCACTGGGGCGTAGCCATTGCCGATCTGACCAGGG*TGGTTCATGATGATGACCTGGGAGGTGAAGTT
GGCCGCCTCCTTGGCAGGGTCATCCTT*GGAGTTGGATGCAACAAACCCACGCTTCAGATCCTTCACAG*CAACGTTCTT*GACGTTGAAGCCAACGTTG
TCACCAGGAAGCGCCTCCAGGAGAGACTCATGGTGCATCTCAACAGACTTAACCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCT
TGATGACACCAGTCTCAACACGGCCAACAGGCACAGTTCCAATGCCACCAATCTTGTAAACATCCTGAAGGGGAAGACGCAGGGGCTTGTCTGAGGGCCT
CTTGGGCTCATTGATCTGGTCAAGAGCCTCAAGAAGGGTAGGGCCCTTGTACCAGTCAAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCAAACCCA
GAGATGGGAACGAAGGGAACCTTGTCAGGGTTGTAGCCGACCTTCTTCAGGTACGAAGAGACTTCCTTGACAATTTCCTCATAACGGGCCTTTGAGTACT
TGGGAGTGGTGGCGTCCATCTTGTTGCAGCAGCAGATCATCTGCTTCACTCCAAGGGTGAAAGCAAGGAGGGCGTGCTCACGGGTCTGGCCATCCTTGGA
GATACCAGCCTCAAAACCACCAGTGGTGGAGTCAATGATGAGCACAGCACAGTCAGCCTGGGAGGTACCAGTAATCATGTTCTTGATGAAGTCACGGTGA
CCAGGGGCATCAATGACGGTGCAGTAGTACTTGGTGGTCTCGAACTTCCACAGGGCAATATCAATGGTGATACCCCTCTCACGCTCGGCCTTCAGCTTGT
CAAGCACCCAGGCGTACTTGAAAGACCTCTTGTTCATCTCAGCGGCTTCCTTCTCAAACCTCTCGATCACACGCTTGTCAATACCTCCAAGCTTGTAGAT
CAGATGGCCAGTGGTTGTCGACTTGCCAGAGTCGACATGGCCAATGACCACGATGTTGATGTGAGTCTTCTCCTTACCCATGGCTGGAGCT*CCGAGGAA
GGAGAAGGAACCGAGaggaggcggcggcgc
page-top