Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16220  (registered. 2002)
Contig Information
Length 680 bp
Clones 83 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 83
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Em protein >gi|21733|emb|CAA68322.1| unnamed protein product [Triticum aestivum] >gi|4007838|emb|CAA65308.1| Em protein [Triticum aestivum]
Score 385
Evalue 1.53746e-35
Total Hit Count 82
Registered year 2002
Contig Sequence     [ Download ]
>Contig16220
ttttttttttgAGCAAGACGACATGCATTACTGAAG*AAGCAAGGATACA*GTGG*ACACTGCG*ACACT*CCTGGGCCCAGAGGCAG*ACCAGCCACCT
G*ACCAAGCCACAGTACGCTTCCGACTTAACCTGACGCTACTCAC*CGTAGAGTAGCTACAGACTACCAGCTACGAAGCACACATGATCATACTACGTAC
GATCGC*CTACGTGCGCCTGAACTACATTATTCGGTACGTAGACACTAGGGCAAACCAACAGCCGACCTAAGGAGATTCGTCTTGCTTGCTAGGGTAACA
*GATCAT*CTAGGACTTGGT*CTTGAACTTGGACTCGTCGATGTCGATGCCCT*CCCTGGCGGCGCGGTCGCCGCCGGACTCGTCGTTGGTGCTCAGCCC
GCCCTTGCGCCCCATCTGGC*TGTACCCCTCCTCCCCCATCTGCT*CCC*TGCGAGTC*TGCCCGCCACGGCTGCGCCCTTCGGCGAGGTTCTCCTGCGC
CTCGAGGGACTTGCCGCCGGTGCCACCGGGGACGACGGTCTCGCCCTCGCGGGCCTTGCGGTCCAGCTGCGACCTCT*CCTGCTGACCGGAAGCCATTGC
TCTCTCTGCCTGCCTTGCTACTACAACCTCAACTGGG*AAACGTTGTGTCACTG*CTTGTAAGGTGGTGTTCgtgattgc
page-top