Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16219  (registered. 2002)
Contig Information
Length 1091 bp
Clones 83 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 14
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 10
Wh_f Spike at flowering date 8
Wh_h Spike at heading date 11
Wh_oh Pistil at heading date 13
Wh_r Root 5
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|1703380|sp|P51823|ARF2_ORYSJ RecName: Full=ADP-ribosylation factor 2 >gi|1132483|dbj|BAA04607.1| ADP-ribosylation factor [Oryza sativa Japonica Group] >gi|13646976|dbj|BAB41081.1| ADP-ribosylation factor [Triticum aestivum] >gi|23304413|emb|CAD48129.2| ADP-ribosylation factor 1-like protein [Hordeum vulgare subsp. vulgare] >gi|50511366|gb|AAT77289.1| ADP-ribosylation factor [Oryza sativa (japonica cultivar-group)] >gi|113579443|dbj|BAF17806.1| Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|125552797|gb|EAY98506.1| hypothetical protein OsI_20417 [Oryza sativa Indica Group] >gi|125594700|gb|EAZ34759.1| hypothetical protein OsJ_018242 [Oryza sativa (japonica cultivar-group)] >gi|215692842|dbj|BAG88186.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695044|dbj|BAG90235.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767619|dbj|BAG99847.1| unnamed protein product [Oryza sativa Japonica Group]
Score 859
Evalue 2.12218e-95
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16219
gcatTTCTCTCCTCCTCCTCCTGCCCCGATCCCGAACC*GGG*AGGAACCCGGCGCGAGG*AGGGCAAAGG*AAGAGAAGAGGAGATCACCGAGCCCAGC
GCGCGCACAGGACAGCAGGCGCCGCGATCTCGCGCAGGAGCGGAGATGGGGCTCACGTTCACGAAGCTGTTCAGCCGGCTCTTCGCCAAGAAGGAGATGA
GGATCCTCATGGTCGGTCTCGATGCGGCTGGTAAGACCACCATCCTCTACAAGCTCAAGCTCGGAGAGATCGTCACC*ACC*ATCCCCACAATCGGGTTT
AATGTCGAAA*CTGTAGAGTACAAGAACATTA*GTTTCACCGTTTGGGATGTCGGGGGTCAGGACAAGATCAGGCCCCTGTGGAGGCACTACTTCC*A*G
AACACCCAGGGTCTCATTTTTGTCGTGGACAGCAATGACAG*AG*AGCGTGTTGTTGAGGCAAGAGATGAGCTTCACCGGATGCTGAATGAGGATGAGCT
GCGTGATGCTGTGCTGCT*GGTGTTTGCCAACAAGCAAG*ATCTTCCTAATGCCATGAACGCTGCT*GAAATCACTG*ACAAGCTTGGCCTGCATTCTCT
GCGCCAGCGACACTGGTACATCCAG*AGCACATGTGCTACC*TCTGG*AGAGGGGGTTGTACGAGGGGCTTGACTGGCTGTCCAACAACATTGCCAACAA
GGCTTGAAGCATCTCGGCAGGGGCTTCTATGGATCTGGATAAGCTGGATATTCGGAC*TAATACTGCCTTTACGTATTATAAACTATATAGTC*TTGACA
G*ATAATGTGGGTGTTTTGGAAAGATAAAGCTCTCTGTCAAAGAGC*TAGCTATCAGATTGTTTTCGTGGGTGTTAAATTGT*CCGTGGCGCTGTTTGTT
TGCCCAT*CATGGTTTTACTATGTCCG*CTTTGTACTCTGTACTCGCCACTCCGACAGACTTGATACATTGTAGTATTGACTTGTCTTGGCATAGTTTGT
CAGCGTGTCTTCTgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaancccccccccnnnaaaaaaa
page-top