Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16210  (registered. 2002)
Contig Information
Length 996 bp
Clones 77 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 11
Wh_SL Seed DPA30 11
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 6
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 16
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Wh_yf Spikelet at early flowering 18
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S9 [Zea mays] >gi|195625718|gb|ACG34689.1| 40S ribosomal protein S9 [Zea mays] >gi|219885117|gb|ACL52933.1| unknown [Zea mays]
Score 922
Evalue 1.70746e-97
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16210
gaggaattcggcacgaggcggcggcggcggcagcggaagaaAGAGGAGAG*AGCTCCAGCCATGGTGCACGTCAACTTCTACCGCAACTATGGTAAG*AC
ATTCAAG*AAACCAAGG*CGTCCTTATG*AG*AAGGAGCGTCTTGATGCAGAACTAAAGCTGGTCGGTGAATATGGACTGA*GGTGCAAGCGTGAGCTCT
GGAGGGTTCAGTATGCACTGAGCAGGAT*TCGTAATGCTGCAAG*ACACTTGCTCACACTGGATGAGAAAAATCCCC*GCCGTATCTTTGAGGGCGCGGC
CCTTCTCCGTCGCATGAACCGCTATGGTCTCCTTGCTGAGGGCCAGGATAAGCTTGATTACGTCCTT*GCCCTGACTGCTGAGAACTTCCTTGCAAGGCG
CCTTCAGACTCTTGTCTTCAAGGCTGGCATGGCAAAATCCATCCACCATGCCCGTGTCTTGATCAGGCAACGCCACATCAGGGTTGGCAGGCAGATCGTC
AATGTCCCCTCGTTCATGGTGAGGGTTGAATCTGAGAAGCACATCGACTTCTCACTGACAAGTCCATT*CGG*TGGAGGCCCTGCAGGCAGGGTGAAGAG
AAAGAACCAGAAGAAGGCAAGTGGTGGCGGTGACGCCCGGTGGTGACGAGGAAGAGGAATGAGGAACTAGTAGCTATCACCTTATATTTATCAAATGTTG
GTGTTATGAGTACTTTAGCTGAGAGGCCTGAGACTTTC*ATGGGTTATCC*TC*TTGTCATTTTGTCACTTTATCACTGTTGTTAG*CATGTATGCACTG
*C*TTTATGTTTGGAGCTATTTGGTCGTGATGAAAGTTATCTAAAAATGTTCTTGACtatgacctggaatcctccttcaattgcttctgttggggtggtt
gtctgatagttcataggaancaacctttcttttcgagtaaatgnatnactttgatatccattngctggttcataggatatcaacctttcttttcga
page-top