Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16192  (registered. 2002)
Contig Information
Length 1314 bp
Clones 68 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 13
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 8
Wh_r Root 7
Wh_yd Spikelet at late flowering 10
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein homologue [Hordeum vulgare subsp. vulgare]
Score 1235
Evalue 3.49938e-136
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16192
ttattttgagagggaagtgacaagaAAAACTCAGTTGTTGCTTCATAAGAAAGGCAAGCTTTGGGGGTGCTTGACGCCAAGTATGATCAAT*CAT*CAAC
AAGCCATGAAAATTGCTAATACAGCAATACTAATAATGTGCTGCAATACAGG*AAATAGTTTGAAATCTGCTAATGAACTAAG*AAGCGACGATGTCCAC
ATGAC*CGTCCTCATGACTGTAGTCCACTAGGTACTTCAGCTCGACACGCTTCGCATAGCACCATCCTACCACATCTTATGATTCACATAGTGCAACCGA
CCCTAGTACATCTTATGATCCGAATGATACAGGTAGCTGCGTAAATGGACTCAGAAATAAACTTGGGCACGCTCGAGGGCCAATCAGTGCCCCTCTCCCT
CAGGCTTTGAGGCGGCTTCCTTGATCTCATCACCACCCTCCTCTGCGTTATCGGAGGTCCAGAGAGTCAAGTTGTCACGAAGAAGTTGCATGATCAAGGT
GCTGTCCTTGTAGGATTCCTCGCCGAGGGAGTCCAGCTCAGCAATAGCTTCATCAAATGCCTGCTTGGCAAGGTTGCAAGCACGGTCTGGAGAGTTCAGG
ATCTCATAGTAGAACACTGAGAAGTTGAGTGCAAGTCCAAGCCTTATCGGGTGGGTGGTAGGCAAGTCAGCAAGCGCGATGTCCTGGGCTGACTTGTATG
CTACAAGA*GTGTTCTCAGCTGCTTCTTTCCTCTCAGCGCCTGCCTTGAACTCCGCAAGGTACCT*GTGGTAGTCACCCTTCATTTTCAGATAGAACACC
TTGGACTCTGCTGCAGTGGCAGA*GGGGACAAGGTGGGAGTCCAGAAGCTTGAGGATGCCATCACAGATCTTGCTGAGCTCAGTTTCAATCCTGGTACGG
TACTCCTTGATTGAAGCAACATAGGCCTCGTTCCCACGGCTCTCCTCCTTCTGCTCAATGGAGGAGATGATCCTCCAGGAAGCCCTCCGGGCACCAATCA
CATTCTTGTAAGCAACAGAGAGCAGGTTGCGCTCCTCAACAGTGAGCTCACCAACATCAGCGGTCTTTGCCACCTTCT*CCATGAACTCAACCATTT*CT
TCGTAACGCTCAGCCTGCTCGGCAAGCTTgcacCATGTACACATTCTCCTCACGGGTTGCCTCAGCGGTAGACATTTTCCCTCTT*CTTTGTTGCAAACT
AGTTCAGTGCCTTTCCT*CTCGCGCTTCGCTTTT*CTCACGGGCTTCGGCTGCGGAT*CTCGGGAGCGCGACTGTGGGTTCGTGgggggcggggggggat
aggcctcgtgccga
page-top