Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5333  (registered. 2012)
Contig Information
Length 789 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62275661|gb|AAX78232.1|| embryonic flower 2 [Triticum aestivum]
Score 332
Evalue 4.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5333
TTTTAGATAGGTTTTATTGTAGCAAGGAACACTGATTCAAGTTTGCAGACCATACGGCAAGTTCTGCAACACTAAAGGCGCTTATCCATGGAACAGAACA
CGACGAACAACAACAATCCATGTAAACACATCTCATCCGGATCACTGCTGCTTCAACACAACCGATCGATAAATAGAATCGAGAATAGTCCTCCATGGCC
TCAGGTGCAGCTTTCACCTCTCTTTAGCCTGCTCCTAAGGCCTCCTCCAAACACCCACTTGATTTAAATTATAATGAGCGCACTATGCTCGACTCACATT
TTCTTGGGGTCCGAGCTTTCATTTTGGTAGCCTTGAAGAATTGTGCCGCAGACATTCATGGCGCGGGCATCTAATAGACTGTGGTTCCAGAGTTTAATCA
TAAGGAAACGCCAGCTCCATAGTAGAGGAGGATTCTGTACAAGATGTTTTCCATGAAGCCGGGAGAATGCCTCACAGGCCCAAGGAATATGACCATCAGC
TAGCACCCTTTGTTTCCGAACAAATGAATTCCACATATGCATAATAAGTTTCTCATCGTCTGTAACGTCAACAAAATCCTCAAGCATCCGTTTATCTTCA
AAATCGGCGATGTCATCATCAACTTCATCTTCACTATCACGGTCCGAGAAAACTTGTTCCAGTGCCATTGGCTGTGCCCTGTGAGAATGGAAAAACTGAC
GTTTCTGCANNNNTTGCCGGTTTCTGGGATCAGCTCGCTCCGCAGNTAGTTTCCTTGTCTTCCCAAACTGTAGTACTGTGGGTGGTGAA
page-top