Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16188  (registered. 2002)
Contig Information
Length 1016 bp
Clones 67 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 14
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 6
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 6
Wh_r Root 6
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L18 [Triticum aestivum]
Score 948
Evalue 1.71945e-100
Total Hit Count 349
Registered year 2002
Contig Sequence     [ Download ]
>Contig16188
ttcggcacgaggcggacgaGGTAAGAAGCAGCAGCCGCAG*CGCGACCCCGCGAG*AAACCCTACCGCCGCCGCCGCAG*AAGCAGCCATGGGTATCGAC
C*TCGTTGCCGGCGGGAGGAAC*AAG*AGGACCAAGCGCGTCGCGCCCAAGTCCGACGATGTCTACCTCAAGCTCCTCGTCAAGCTCTACCGTTTCCTGG
TGAGGAGGACCAAGAGCAAGTTCAACGCCGTCATCCTCAAGAGGCTCTTCATGAGCAAGACCAACC*GCCCGCCGCTCTCCATGCGCCGCCTCTCCAACT
TCATGAAGGGAAAGGAGGAGAAGAACATTGCTGTGGTTGTTGGTACAATCACAGATGACATGCGGATCCAAGAGGTCCCAGCAA*TGAAGGTTACCGCTC
TGAGGTTCACAGAGACAGCGAGGGCAAGGATTGTCAATGCTGGTGGGGAGTGCCTCACTTTTGACCAGCTTGCACTCCGTGCTCCAACTGGGGAGAACAC
GATCCTGTTGAGGGGACCCAAGAATGCCCGTGAGGCGGTGAGGCACTTCGG*CAAGGCGCC*T*GGTGTGCCGCACAGCCACACCAAGCCCTATGTGCGC
TCCAAGGGTAGGAAGTTTGAGAAGGCTCGTGGTAGGAGGAACAGCCGTGGCTTCAAGGTTTAA*GTCGCCCTTTCTGTGTAG*TCGCTGTTTGCGGGGAG
CGACTGGTGTT*CTGTTTGAGCAATTGACAGTAATTAGTAAAGTACTTTGTACTGAGAGTAGCACAATCTATCGCCCCCGTGTTCGG*ATGATATTTTGG
AAGATCCTTATCGCTGTCATCTGTTTTGAATTTTTGAGCTTGAAGACCATGTTTTGTTGCTTTTCTGTTGACAATGTCCACTGGTGAATGTGTCTATGTG
CGCTCCAGTTTGCAGTATCATTGTGTTAACTTTGTACCCATCTGTTGCTTAGCAACATATAATTCTGTAGGGCATTTAAACTTGTTAAATGCAACTTGAT
TCTGAgaaaaaaaaaa
page-top